All of it. I'm still waiting for you to show me how information in the DNA code can increase....as well as how mutations have the ability to add up.
Upvote
0
-
Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.
-
CF has always been a site that welcomes people from different backgrounds and beliefs to participate in discussion and even debate. That is the nature of its ministry. In view of recent events emotions are running very high. We need to remind people of some basic principles in debating on this site. We need to be civil when we express differences in opinion. No personal attacks. Avoid you, your statements. Don't characterize an entire political party with comparisons to Fascism or Communism or other extreme movements that committed atrocities. CF is not the place for broad brush or blanket statements about groups and political parties. Put the broad brushes and blankets away when you come to CF, better yet, put them in the incinerator. Debate had no place for them. We need to remember that people that commit acts of violence represent themselves or a small extreme faction.
Here's my problem, I believe in evolution, and it brings up doubts especially in the OT...
- Thread starter Neogaia777
- Start date
- Status
Subduction Zone
Regular Member
You seem to be conflating the fact of evolution with the theory of evolution. The evidence supporting the theory of evolution more than shows that it is a fact.
And of course there are processes that allow DNA to change so that evolution can occur. I am positive that this has been explained to you. The fact that you won't let yourself understand is not evidence against the theory.
Upvote
0
Evolution is both a theory and a fact, just as gravity is both a theory and a fact.
"Well, evolution is a theory. It is also a fact. And facts and theories are different things, not rungs in a hierarchy of increasing certainty. Facts are the world's data. Theories are structures of ideas that explain and interpret facts. Facts do not go away when scientists debate rival theories to explain them. Einstein's theory of gravitation replaced Newton's, but apples did not suspend themselves in mid-air, pending the outcome. And humans evolved from apelike ancestors whether they did so by Darwin's proposed mechanism or by some other, yet to be discovered."--Stephen Jay Gould, "Evolution as Theory and Fact"
http://www.stephenjaygould.org/library/gould_fact-and-theory.html
That is a bare assertion. You have never backed it with evidence.
Upvote
0
Explain how information is measured.
From what I have seen, creationists like yourself can never measure information. You can't even define it in a meaningful way. For example, what is the information content of this DNA sequence:
CAAGTTAAACTGCTGGGGAACCGCGTTTCCACGACCGGTGCACGATTTAATTTCGCCGACGTGACGACATTCCTGCTAATGCCTCACCCGCCGGACCCCTCTCGTGATGGGGTAGCTGGACATGTCCTTGTGAGATATAACAAGAGCCTGCCTGTTTAATGATCTCACGGCGAAAGTCGGGGGGACAGCAGCGGCTGCAGACATTATACCGCAACAACACTAAGGTGAGATAACTCCGTAGTTGACTACGCATTCCTCTAGACCTTACTTGACCGGATACAGTGACTTTGACACGTTTGT
Upvote
0
Subduction Zone
Regular Member
It would help if you used proper terminology. You are using a loaded term. Perhaps instead you should ask how new traits are added.
Upvote
0
Subduction Zone
Regular Member
You have not defined what you mean by "information". You seem to know what a trait is. And we can explain how those are added. By the way, any reasonable definition of "information" will allow it to be increased through the evolutionary process. This is a prediction, but I have not seen a creationist that could both come up with a reasonable definition of information and show that known processes would not increase it.
Upvote
0
Upvote
0
Since you can't measure information, or even define information, how are we to tell? As I asked before . . .
What is the information content of this DNA sequence:
CAAGTTAAACTGCTGGGGAACCGCGTTTCCACGACCGGTGCACGATTTAATTTCGCCGACGTGACGACATTCCTGCTAATGCCTCACCCGCCGGACCCCTCTCGTGATGGGGTAGCTGGACATGTCCTTGTGAGATATAACAAGAGCCTGCCTGTTTAATGATCTCACGGCGAAAGTCGGGGGGACAGCAGCGGCTGCAGACATTATACCGCAACAACACTAAGGTGAGATAACTCCGTAGTTGACTACGCATTCCTCTAGACCTTACTTGACCGGATACAGTGACTTTGACACGTTTGT
More importantly, which mutations at which bases will increase or decrease that information content?
Upvote
0
Until you define what information is and how to measure it, I can't answer your question. "Information" is something you invented, so you need to define it. I will ask again.
What is the information content of this DNA sequence:
CAAGTTAAACTGCTGGGGAACCGCGTTTCCACGACCGGTGCACGATTTAATTTCGCCGACGTGACGACATTCCTGCTAATGCCTCACCCGCCGGACCCCTCTCGTGATGGGGTAGCTGGACATGTCCTTGTGAGATATAACAAGAGCCTGCCTGTTTAATGATCTCACGGCGAAAGTCGGGGGGACAGCAGCGGCTGCAGACATTATACCGCAACAACACTAAGGTGAGATAACTCCGTAGTTGACTACGCATTCCTCTAGACCTTACTTGACCGGATACAGTGACTTTGACACGTTTGT
More importantly, which mutations at which bases will increase or decrease that information content?
Upvote
0
Thr real answer? None. A random blind process can't increase the information to the point a new trait can be coded for.
Can't happen.
Upvote
0
Still waiting for an answer.
What is the information content of this DNA sequence:
CAAGTTAAACTGCTGGGGAACCGCGTTTCCACGACCGGTGCACGATTTAATTTCGCCGACGTGACGACATTCCTGCTAATGCCTCACCCGCCGGACCCCTCTCGTGATGGGGTAGCTGGACATGTCCTTGTGAGATATAACAAGAGCCTGCCTGTTTAATGATCTCACGGCGAAAGTCGGGGGGACAGCAGCGGCTGCAGACATTATACCGCAACAACACTAAGGTGAGATAACTCCGTAGTTGACTACGCATTCCTCTAGACCTTACTTGACCGGATACAGTGACTTTGACACGTTTGT
More importantly, which mutations at which bases will increase or decrease that information content?
If you can't answer these questions, then your assertions are unsupported.
Upvote
0
- Status
Similar threads
