What is "design" and how to detect it

[The Barbarian]

It occurs to me that when you say a watch is a man-made object it gets a pass

Because it has obvious signs of manufacture. You can, for example, show marks where the various parts were stamped, cut, or machined. And of course, we have all sorts of evidence that people make watches.

whereas when people say life was designed evidence is demanded.

Yep. Same standards. No sign of "design", but then you wouldn't expect that from an omnipotent Creator.

Where's your evidence the object Paley got out of the ground was a man-made object?

See above. Think about it. Shouldn't be hard if you think a little.

Barbarian observes:
Failing to show that geneticists saw non-coding DNA as being functionless, you repeated your assertion. When will we see your supporting data?

Predictions of non-functionality of “junk DNA” were made by Susumu Ohno (1972), Richard Dawkins (1976), Crick and Orgel (1980, Pagel and Johnstone (1992), and Ken Miller (1994), based on evolutionary presuppositions.

Show us that, with the evidence of "evolutionary presuppositions." As you know, much of non-coding DNA is functionless, but as Darwin predicted, vestigial features often are used for new purposes. Would you like to see that? Instead of functional non-coding DNA being a refutation of Darwinian theory, it's another confirmation of Darwinian evolution

By contrast, predictions of functionality of “junk DNA” were made based on teleological bases by Michael Denton (1986, 1998), Michael Behe (1996), John West (1998), William Dembski (1998), Richard Hirsch (2000), and Jonathan Wells (2004).

In the 1960s, biologists were talking about functions of non-coding DNA. Your guys are a few decades late. But creationists often borrow discoveries by real scientists, and claim them for their own.

Barbarian explaining why transitional forms to the "gear" exist:
The basic idea is repetitive "teeth" in which two parts of the exoskeleton interdigitate and move against each other. So, this is a pretty good example of exaption, a feature evolved for one purpose, that's recruited for another.

There's simpler examples of this for locomotion as well; the furca of springtails has teeth that interdigitate and then release to allow jumping. So the argument boils down to "I just don't think it could evolve, even though there are simpler examples."
Click to expand...

Those aren't transitional forms of functional gears,

You'll need more than hand-waving to support that assumption. In fact, as you just learned, the teeth, the legs, and the two limb segments are already there. Simply denying that it could go any further is pointless.

Barbarian observes:
It's called "mutation and natural selection."

Which they discovered is limited to micro-evolution.

Nope. Speciation is well documented. Want some examples?



Developmental gene regulatory network architecture across 500 million years of echinoderm evolution
Evolutionary change in morphological features must depend on architectural reorganization of developmental gene regulatory networks (GRNs), just as true conservation of morphological features must imply retention of ancestral developmental GRN features. Key elements of the provisional GRN for embryonic endomesoderm development in the sea urchin are here compared with those operating in embryos of a distantly related echinoderm, a starfish. These animals diverged from their common ancestor 520-480 million years ago. Their endomesodermal fate maps are similar, except that sea urchins generate a skeletogenic cell lineage that produces a prominent skeleton lacking entirely in starfish larvae. A relevant set of regulatory genes was isolated from the starfish Asterina miniata, their expression patterns determined, and effects on the other genes of perturbing the expression of each were demonstrated. A three-gene feedback loop that is a fundamental feature of the sea urchin GRN for endoderm specification is found in almost identical form in the starfish: a detailed element of GRN architecture has been retained since the Cambrian Period in both echinoderm lineages. The significance of this retention is highlighted by the observation of numerous specific differences in the GRN connections as well. A regulatory gene used to drive skeletogenesis in the sea urchin is used entirely differently in the starfish, where it responds to endomesodermal inputs that do not affect it in the sea urchin embryo. Evolutionary changes in the GRNs since divergence are limited sharply to certain cis-regulatory elements, whereas others have persisted unaltered.

Surprise.

How does this advance your case exactly?

It shows that evolution of developmental gene regulation is a fact, contrary to your denials. The genes persist, but contrary to your assumptions, they evolve over time, so they aren't the same.

 

[SkyWriting]

Seriously? New information has to be beneficial?
Does this mean the damaging Thalassemia or Sickle-cell trait mutations are not new information unless you catch malaria, where they are beneficial, and so become new information after all?

I wouldn't say that Sickle-cell trait is new, any more than blond hair is new information.
Or any variation is new information.
Some variations just survive well.

 

[SkyWriting]

Do all of the differences between the human and chimp genomes cause disease and decay?

You seem to have shunned other family members of yours.

Humans are more closely related to flies and worms than previously thought, genome studies suggest.

 

[Jimmy D]

You seem to have shunned other family members of yours.

Humans are more closely related to flies and worms than previously thought, genome studies suggest.

What's your point?

From the arcticle:

"One way to describe and understand the human genome is through comparative genomics and studying model organisms. The special thing about the worm and fly is that they are very distant from humans evolutionarily, so finding something conserved across all three - human, fly and worm - tells us it is a very ancient, fundamental process," Mark Gerstein of Yale University and lead author of one of the articles, said.

Doesn't sound like an argument for design.

 

[SkyWriting]

What's your point?

That so many folks often use the chimp argument, rather than the fly or worm argument.
Why is that? Isn't science supposed to be real rather than fun?

 

[Jimmy D]

Chimpanzees are our closest relatives and, as your article points out, the worm and fly are distant relatives.

I still don't know what point you're making though, I thought you were a creationist yet you're posting articles describing the usefulness of the TOE in medical research.

 

[SkyWriting]

Chimpanzees are our closest relatives and, as your article points out, the worm and fly are distant relatives.

I still don't know what point you're making though, I thought you were a creationist yet you're posting articles describing the usefulness of the TOE in medical research.

So you are surprised that I'm well informed about ToE? That would be my reason for posting.

And that blurb about being "distant relatives" is just feel-good malarky to make the results easier to swallow.

Abstract
The 97-megabase genomic sequence of the nematode Caenorhabditis elegans reveals over 19,000 genes. More than 40 percent of the protein products find significant matches in other organisms.

 

[SkyWriting]

I still don't know what point you're making though, I thought you were a creationist yet you're posting articles describing the usefulness of the TOE in medical research.

You should have spotted the point. There were three sentences.
"That so many folks often use the chimp argument, rather than the fly or worm argument.
Why is that? "

I'll have to drop to one sentence.

 

[The Barbarian]

And that blurb about being "distant relatives" is just feel-good malarky to make the results easier to swallow.

Comes down to evidence. As you should know, chimps are close to identical to humans in genes, while other species are increasingly different as we move away from hominins. The remarkable thing is that genes give us the same family tree as the tree of Linnaeus, who didn't even know about evolution.

 

[sfs]

There seems to be some confusion on the matter of junk DNA. Biologists still think that the sequence of most human DNA has no effect on our health or reproductive ability, or on any other meaningful trait.

 

[The Barbarian]

London - Mice can survive despite having whole pages of DNA ripped out of their "book of life", scientists have reported in a study which could have implications for humans.

Researchers deleted more than two million bases, the chemical "letters" of the DNA code, from the mouse genome. But to the surprise of the scientists, the mice shrugged off the loss and were virtually unaffected.

Although the deleted sequences were from regions of the genome not known to have any essential function, the result was unexpected.

Eddy Rubin, director of the Joint Genome Institute in Walnut Creek, California, where the work was carried out, said: "In these studies, we were looking particularly for sequences that might not be essential.

"Nonetheless we were surprised, given the magnitude of the information being deleted from the genome, by the complete lack of impact noted.

"From our results, it would seem that some non-coding sequences may indeed have minimal if any function."
http://www.news24.com/SciTech/News/Mice-survive-after-DNA-loss-20050117

That much of our non-coding DNA has adapted to other functions, does not mean that all, or even most of it has.

 

[Loudmouth]

Since you ask, I've found myself intrigued by the cosmologies of Drs. John Hartnett and Russell Humphreys. You'd probably consider them literalists. Each has investigated ways, using GR, to marry an old universe with a young earth.

None of them work, however. One of the larger problems for Humphreys' ideas is that it predicts a blueshift for distant galaxies. This isn't observed. In fact, we observe just the opposite, a redshift.

You and these two gentlemen seem to be have the same problem in your approach, you start with the conclusion. You then throw out evidence that conflicts with that conclusion.

What I find most interesting is that the beginnings of geology in the 1700's and early 1800's were primarily driven by Christians who expected to find a young Earth and overwhelming evidence for a recent global flood. They were quite stunned to find just the opposite. The vast majority of them had the humility and temerity to understand that their understanding of the Bible may have been wrong.

 

[Loudmouth]

Because it's coded digital information.

So is every molecule.

Nice try, but 2H2 + O2 ----> 2H2O is using the semantic and syntatic information of the English language. Whereas the semantic and syntatic information is a property of the genetic code itself.

It is a part of H2O also.

It has it's own coding and translation machinery within a cell, we only translate it to English to study it.

We translate water into H2O in the same way. Also, substrates such as metals serve as translation machinery to create H2O from H2 and O2 in the very same way that ribosomes act as catalysts for translation of proteins.

It was a big deal in 2012 when they published this:
These analyses portray a complex landscape of long-range gene–element connectivity across ranges of hundreds of kilobases to several megabases, including interactions among unrelated genes (Supplementary Fig. 1, section Y). Furthermore, in the 5C results, 50–60% of long-range interactions occurred in only one of the four cell lines, indicative of a high degree of tissue specificity for gene–element connectivity49.
http://www.nature.com/nature/journal/v489/n7414/full/nature11247.html

You find the words "complex" and "specificity" in different parts of an abstract and think that somehow relates to the term "specified complexity" used by ID/creationists? Seriously?

What we you need to show us is how you measure specified complexity in DNA. Here is a practice sequence:

GAGTGGTGACGGTTATTCCCCAGGAATGGACTTC
TTATTCACAGTCGGTCACATTGGGCTACTCCTTGG
GTCTTCCGCTTGGCCCGGTCTGTTGGGCCGC

Show us the methods that ID/Creationists use to determine if that DNA sequence has specified complexity.

"evolution increases information defined y Shannon" So what? Do you understand adding information and adding functional information are two different things?

Do you? Can you show how they are different?

Also, "ev" is a computer simulation. It was designed to search a space for a target and finds said target. It's not a true blind or unguided search.

The process that added mutations to model DNA sequence was not looking for a target. The mutations were random. All the model did was apply selection to the resulting random changes, and what resulted was an increase in binding efficiency. It showed how a DNA promoter region and a DNA binding protein can co-evolve. If that isn't functional information by your definition, then evolution doesn't need to produce functional information as you define it. Having promoter regions and DNA binding proteins change their binding capacity will change protein expression of the gene downstream from the promoter. This can cause phenotypic change, exactly what evolution needs to produce.

That was a study of population genetics by Cornell university, not Behe. Not surprisingly they didn't agree with Behe's calculations and methods. So they repeated Behe's calculations using evolutionist methods. Their calculations showed it would take 162 million years for two coordinated mutations to occur and fix within humans. Which flies in the face of Darwinian evolution producing macro-evolutionary changes, thus the clue in the title "..and the limits to Darwinian evolution". It's a post-Darwin world.

Let's see the studies.

I've never denied life evolved. I accept the theory of evolution as true. It's the theory of common descent I doubt since common design fits that pattern better.

How does a nested hierarchy fit common design? Why would common design produce a nested hierarchy?

 

[Loudmouth]

They based it on specified complexity. William Dembski, for intelligent design theory, said this in 1998: "On an evolutionary view we expect a lot of useless DNA. If, on the other hand, organisms are designed, we expect DNA, as much as possible, to exhibit function."

About 90% of the human genome is junk DNA. As sfs mentions, only 10% of the human genome shows evidence of selectable function.

The real problem is that you are trying to use a definition of "function" that is rather ridiculous. If you define function as "does something" then even real junk would have function. Afterall, the trash in you kitchen trashcan releases biomolecules into the air which is doing something. Unfortunately, this is the definition that the ENCODE project chose to use. If a gene was transcribed into RNA they considered that stretch of DNA to be functional. What they never did was determine if that RNA molecule actually had any impact on the health or well being of any human. When we define function as "affecting the fitness of the organism" then only about 10% of the human genome shows evidence of function.

 

[Loudmouth]

You seem to have shunned other family members of yours.

You seem to have ignored the question.

Do all of the differences between the human and chimp genomes cause disease and decay?

 

[Loudmouth]

Abstract
The 97-megabase genomic sequence of the nematode Caenorhabditis elegans reveals over 19,000 genes. More than 40 percent of the protein products find significant matches in other organisms.

When we compare the sequence of those proteins we find pretty big differences between some of those species. According to you, these differences should produce disease and decay, yet they don't.

How do you explain this?

 

[ChetSinger]

None of them work, however. One of the larger problems for Humphreys' ideas is that it predicts a blueshift for distant galaxies. This isn't observed. In fact, we observe just the opposite, a redshift.

I believe he's changed his model since then and it doesn't have that problem anymore.

You and these two gentlemen seem to be have the same problem in your approach, you start with the conclusion. You then throw out evidence that conflicts with that conclusion.

Well, my approach begins with my own experiences. Those are the shoes I've been walking in. I was a Christian for two decades, watching God work in people's lives (including my own), before I ever took a serious look at crevo-related issues.

What I find most interesting is that the beginnings of geology in the 1700's and early 1800's were primarily driven by Christians who expected to find a young Earth and overwhelming evidence for a recent global flood. They were quite stunned to find just the opposite. The vast majority of them had the humility and temerity to understand that their understanding of the Bible may have been wrong.

I'm not interested in geology so I don't have anything to add to this.

 

[Loudmouth]

I believe he's changed his model since then and it doesn't have that problem anymore.

Then you would have to specify the version. From what I have seen, all of the versions have fatal flaws.

Well, my approach begins with my own experiences. Those are the shoes I've been walking in. I was a Christian for two decades, watching God work in people's lives (including my own), before I ever took a serious look at crevo-related issues.

I don't see why that justifies the rejection of scientific evidence in the defense of a dogmatic belief.

 

[SkyWriting]

When we compare the sequence of those proteins we find pretty big differences between some of those species. According to you, these differences should produce disease and decay, yet they don't.How do you explain this?

Different species, as you said. My proteins are not going to attack passersby.

 

[Loudmouth]

Different species, as you said.

Why wouldn't those changes produce decay and disease in different species?

Why are species different to begin with?