What is "design" and how to detect it

[Kylie]

Because I believe it's origin, and the origin of everything here, was supernatural. I'm distinguishing origins from current processes. That is, I believe the processes were originally designed and have since run themselves. Kind of like the watchmaker described by Newton and Descartes. Does God still intervene? Yes, we call such events "answered prayers", "miracles", etc.

And what do you think of the mountains of testable and verifiable evidence that the sun formed through a natural process? Why do you discount that evidence?

 

[FrumiousBandersnatch]

I take it you are unfazed that these words appear in peer-reviewed science, not some religious document:

"A formal demonstration of the universal common ancestry hypothesis has not been achieved and is unlikely to be feasible in principle"

Yes, I'm unfazed. What do you suppose a formal demonstration the universal common ancestry hypothesis would consist of?

 

[FrumiousBandersnatch]

Which computer suse them. The seven in your car?

Which computers use what?

I have no idea what your point is; if you can explain it, I'll try to address it.

 

[ChetSinger]

And what do you think of the mountains of testable and verifiable evidence that the sun formed through a natural process? Why do you discount that evidence?

I don't know how the sun formed. But I'm certain God was behind it, because he's the originator of what we call natural processes. Regardless of whether a Christian believes in a young earth or an old one, we all believe this: "In the beginning God created the heavens and the earth". That is, everything we see is due to the will of God.

 

[ObamaWoodHollyWood]

And what do you think of the mountains of testable and verifiable evidence that the sun formed through a natural process? Why do you discount that evidence?

What are the details?

 

[JonFromMinnesota]

I don't know how the sun formed. But I'm certain God was behind it, because he's the originator of what we call natural processes. Regardless of whether a Christian believes in a young earth or an old one, we all believe this: "In the beginning God created the heavens and the earth". That is, everything we see is due to the will of God.

1. God of the gaps fallacy- "I don't know. God did it"
2. Begging the question- type of circular reasoning where you put the conclusion in your premise.

 

[SkyWriting]

And what do you think of the mountains of testable and verifiable evidence that the sun formed through a natural process? Why do you discount that evidence?

If Jesus were to cause a blind man to see, an autopsy would likely find
his eyes attached to his nerves in a "natural" manner. There is nothing
wrong with the evidence. It's the interpretation of it that is a guess.

"Natural and physical scientists since the 17th century have learned most of what they know about the universe through the scientific method. This method continues to define the way scientists conduct the work of science. It has withstood the test of time.

The scientific method is “a method of research in which a problem is identified, relevant data are gathered, a hypothesis is formulated from these data, and the hypothesis is empirically tested1“ (Table 1). First, the scientist makes an observation or identifies a problem related to that observation. He or she then creates a hypothesis to explain the observation. The hypothesis then allows the scientist to make predictions. The scientist then tests the predictions by experiments or by further observations under controlled conditions.

Falsification is an important element of the scientific method. The scientist ideally attempts to disprove or falsify the hypothesis. If the hypothesis can be disproved, it can then be discarded so that the scientist can move on to a more accurate hypothesis. On the other hand, if experimentation or further observation confirms the hypothesis, this confirmation does not necessarily prove the hypothesis to be true. Other scientists are allowed to test and to attempt to falsify the hypothesis. Repeated confirmations of the hypothesis over time may result in the hypothesis becoming a theory. A theory is a general principle that scientists use to explain phenomena and predict events."

 

[SkyWriting]

"...and the four rules of Conway's Game of Life can animate patterns that can compute or replicate, etc."

Which computer use theses four rules. The seven computer in your car run of the games of life rules?

What other parts of your life use "the four rules of Conway's Game of Life"?

 

[ChetSinger]

1. God of the gaps fallacy- "I don't know. God did it"
2. Begging the question- type of circular reasoning where you put the conclusion in your premise.

Hello Jon. I'm not here for a debate, just conversation.

 

[FrumiousBandersnatch]

Which computer use theses four rules. The seven computer in your car run of the games of life rules?

Huh?? keep taking the meds, kid

What other parts of your life use "the four rules of Conway's Game of Life"?

I have no idea what your point is; if you can explain it, I'll try to address it.

E.T.A. I used Conway's Game of Life as a very simple example of emergence; does that help?

 

[SkyWriting]

I have no idea what your point is; if you can explain it, I'll try to address it.E.T.A. I used Conway's Game of Life as a very simple example of emergence; does that help?

I'm not seeing what you've imagined. Are there any
peer reviewed publications that show emergence?

Are you saying the internet is showing signs of being
more intelligent than a sum of it's parts?

Is your car more intelligent than a sum of it's parts?
Is the world biosystem more intelligent than a sum
of it's parts?

Is Donkey-Kong more intelligent than a sum of it's parts?
Should I check with my great-granddaughter on this?

 

[Loudmouth]

If Jesus were to cause a blind man to see, an autopsy would likely find
his eyes attached to his nerves in a "natural" manner. There is nothing
wrong with the evidence. It's the interpretation of it that is a guess.

How is it a guess?

If Jesus did heal a blind man, would Jesus also produce fake scars from eye surgeries that the man never had, just to make it look like it was done by humans through normal procedures?

Would God also plant fake evidence for natural processes as it relates to geologic, cosmological, and evolutionary histories?

 

[Loudmouth]

I don't know how the sun formed. But I'm certain God was behind it, because he's the originator of what we call natural processes. Regardless of whether a Christian believes in a young earth or an old one, we all believe this: "In the beginning God created the heavens and the earth". That is, everything we see is due to the will of God.

Why couldn't the same thing apply to evolution?

 

[Black Dog]

The concept of intelligent design has been around longer than Darwin. Intelligent design's prediction of finding function for the majority of DNA was validated and evolutionists claim the majority of DNA is useless was debunked. Imagine the rabbit hole scientists would have continued along if they listened to the evolutionists claims.

What evidence did ID proponents use to predict the functionality? How could their claim have been falsified at the time of the claim? Or was it just a guess?

And what rabbit hole? You mean the one that scientists used, the one that led to a more complete understanding of DNA?

 

[Black Dog]

Citations please.

You are composed of new biological information.

 

[Loudmouth]

It's the difference between analog and digital information. Read what I wrote again:
When referring to code, meaning, semantics or syntax these are not metaphors:
"Compelling evidence suggests that the DNA, in addition to the digital information of the linear genetic code (the semantics), encodes equally important continuous, or analog, information that specifies the structural dynamics and configuration (the syntax) of the polymer."
http://link.springer.com/article/10.1007/s00018-013-1394-1A

How is that different than any other molecule?

Also, the title of that article says it all:
"Integration of syntactic and semantic properties of the DNA code reveals chromosomes as thermodynamic machines converting energy into information"
http://link.springer.com/article/10.1007/s00018-013-1394-1

Same semantics and syntactic information as found here:

2H2 + O2 -----> 2H2O

There's no point to split hairs over what a chain reaction is. The point is calling what happens in the cell 'merely chain chemical reactions' is a weak attempt to sweep any complexity or design under the rug. Like saying what happenes inside a computer is merely electricity.

A complex chemical chain reaction is still a chemical chain reaction.

The difference between 'information' and 'complex specified information' was explained in posts #43, #74, #75, #95, and #153.
As Steven Meyer puts it-
"To avoid confusion and equivocation, I realized that it was necessary to distinguish:
"information content" from mere "information-carrying capacity"
"specified information" from mere "Shannon information", and
"specifie information" from mere "complexity"

What is the specified complexity of this sequence?

CAAATCGTCTAGCAAACTGCTGATCCAGTTTAACTCACCAAATTATAGCC

What is the specified complexity of this object?

I keep hearing these terms thrown around, but I have yet to see specified complexity ever measured for anything in biology.

Shannon's information theory tells us about the information carrying capacity of a sequence, not whether the sequence is meaningful or functional.

As it turns out, evolution increases information as defined by Shannon.

Nucleic Acids Res. 2000 Jul 15; 28(14): 2794–2799.

Evolution of biological information


Thomas D. Schneider:

Abstract

How do genetic systems gain information by evolutionary processes? Answering this question precisely requires a robust, quantitative measure of information. Fortunately, 50 years ago Claude Shannon defined information as a decrease in the uncertainty of a receiver. For molecular systems, uncertainty is closely related to entropy and hence has clear connections to the Second Law of Thermodynamics. These aspects of information theory have allowed the development of a straightforward and practical method of measuring information in genetic control systems. Here this method is used to observe information gain in the binding sites for an artificial ‘protein’ in a computer simulation of evolution. The simulation begins with zero information and, as in naturally occurring genetic systems, the information measured in the fully evolved binding sites is close to that needed to locate the sites in the genome. The transition is rapid, demonstrating that information gain can occur by punctuated equilibrium.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC102656/
​

They were trying to show Behe miscalculated but their calculations inadvertendly showed it would take 162 million for 2 functional mutations to appear and fix within humans.

Just as it should take 150 million Powerball lottery drawings to get just one winner since the odds of winning are 1 in 150 million.

Behe is drawing the bulls eye around the bullet hole. He ignores the trillions of dual functional mutations that didn't fix. He is trying to calculate the odds of something happening after it already happened, which is nonsense.

What that means is random mutations aren't the source of genetic change people like to think it is.

What it means is that Behe doesn't know how probabilities work.

Unfazed by these words that appear in a peer-reviewed source?

I agree with them. There hasn't been a formal demonstration of a universal common ancestor. I am just fine with a pool of ancestors. Either way, all life shares the same basic metabolic pathways because of a shared ancestor, and the same genetic systems because of a shared ancestor, even if they aren't the same shared ancestor.

Why don't consider "Science" a real scientific source?

I do. Why don't you? Why do you ignore all of the scientists that state quite clearly that life evolved?

 

[FrumiousBandersnatch]

I'm not seeing what you've imagined. Are there any
peer reviewed publications that show emergence?

I'm not sure what you mean by, 'publications that show emergence'. If you mean published papers about emergence, this is a pretty thorough treatment: The Concept of Emergence in Complexity Science.

Are you saying the internet is showing signs of being
more intelligent than a sum of it's parts?
Is your car more intelligent than a sum of it's parts?
Is the world biosystem more intelligent than a sum
of it's parts?

No to all.

Is Donkey-Kong more intelligent than a sum of it's parts?
Should I check with my great-granddaughter on this?

Yes; yes, I think you should.

 

[SkyWriting]

You are composed of new biological information.

Synthetic people in Blade Runner, perhaps.

For the rest of us, no.

DNA is passed on from parent to child
A child inherits half their DNA from each parent, while each parent passes half their DNA to each child. This is achieved through sexual fertilization, requiring the meeting of the sperm with the egg, and the combining of the DNA from both (since the sperm and egg contain only half the genetic information in the parent). This ensures that families maintain some genetic identity, but also that a child must be genetically different from either parent, or from any of their four grandparents. They will also be genetically different from their brothers and sisters unless they have an identical twin.

The exact halving of the DNA in a parent to produce sperm or egg is possible due to its packaging in each cell as the 23 pairs of chromosomes, such that the sperm or egg has only one copy of a chromosome from each pair. This is achieved through the cell division process of meiosis (see the next page) which occurs only in the germline cells in the testis or ovary.

 

[SkyWriting]

I'm not sure what you mean by, 'publications that show emergence'. If you mean published papers about emergence, this is a pretty thorough treatment: The Concept of Emergence in Complexity Science.

According to your source, the field is vague and poorly defined.
The authors, naturally, claim to have the only understandable
treatment of the topic. While I agree with the first tenant, I
question the second.


http://www.researchgate.net/publica...Finding_Coherence_between_Theory_and_Practice

 

[ChetSinger]

Why couldn't the same thing apply to evolution?

If I'm understand you correctly, Christian theistic evolutionists believe it does. Christian beliefs aren't monolithic in this area.

I'm content to treat the text rather literally. If I'm wrong I don't think God will be upset with me about it.