And you said that we would talk about evolution.
The development of the double helix was an abiogenesis event.
A separate but related topic.
But see, I did answer your question.
Next question please.
Just to clarify evolution deals with life once it exists.
how about the RNA, then
here is a clip from the book: from stephen meyers:
"The Origin of Biological Information
Consider the following sequence of letters:
AGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGT
GGCAAGATCGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGCAGGC
CGAGTACACCGAGGGGTGAGGCGCGGGCCGGGGCTAGGGGCTGAGTCCGC
CGTGGGGCGCGGGCCGGGGCTGGGGGCTGAGTCCGCCCTGGGGTGCGCGC
CGGGGCGGGAGGCGCAGCGCTGCCTGAGGCCAGCGCCCCATGAGCAGCT
TCAGGCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAACC
This string of alphabetic characters looks as if it could be a block of encoded information, perhaps a section of text or machine code. That impression is entirely correct, for this string of characters is not just a random assortment of the four letters A, T, G, and C, but a representation of part of the sequence of genetic assembly instructions for building a protein machinean RNA polymerase28critical to gene expression (or information processing) in a living cell.
Now consider the following string of characters:
01010111011010000110010101101110001000000110100101
1011100010000001110100011010000110010100100000010
0001101101111011101010111001001110011011001010010
00000110111101100110001000000110100001110101011011
0101100001011011100010000001100101011101100110010
1011011100111010001110011001000000110100101110100
This sequence also appears to be an information-rich sequence, albeit written in binary code. As it happens, this sequence is also not just a random array of characters, but the first words of the Declaration of Independence (When in the course of human events
)29 written in the binary conversion of the American Standard Code for Information Interchange (ASCII). In the ASCII code, short specified sequences of zeros and ones correspond to specific alphabetic letters, numerals, or punctuation marks.
Though these two blocks of encoded information employ different conventions (one uses the ASCII code, the other the genetic code), both are complex, nonrepeating sequences that are highly specified relative to the functional or communication requirements that they perform. This similarity explains, in part, Dawkinss observation that, The machine code of the genes is uncannily computer-like. Fair enough. But what should we make of this similarity between informational softwarethe undisputed product of conscious intelligenceand the informational sequences found in DNA and other important biomolecules?
Introduction to an Enigma
I first encountered the DNA enigma as a young scientist in Dallas, Texas, in 1985. At the time, I was working for one of the big multinational oil companies. I had been hired as an exploration geophysicist several years earlier just as the price of oil had spiked and just as I was graduating from college with degrees in physics and geology. My job, as the Texas oilmen put it, was to look for awl out in the guff.
Though I had been a physics and geology student, I had enough exposure to biology to know what DNA did. I knew that it stored the instruction set, the information, for building proteins in the cell and that it transmitted hereditary traits in living things using its four-character chemical alphabet. Even so, like many scientists I had never really thought about where DNAor the information it containedcame from in the first place. If asked, I would have said it had something to do with evolution, but I couldnt have explained the process in any detail.
On February 10, 1985, I learned that I wasnt the only one. On that day I found myself sitting in front of several world-class scientists who were discussing a vexing scientific and philosophical question: How did the first life on earth arise? As recently as the evening before, I had known nothing about the conference where this discussion was now taking place. I had been attending another event in town, a lecture at the Southern Methodist University by a Harvard astronomer discussing the big-bang theory. There I learned of a conference taking place the following day that would tackle three big scientific questionsthe origin of the universe, the origin of life, and the nature of human consciousness. The conference would bring together scientists from competing philosophical perspectives to grapple with each of these issues. The next morning I walked into the downtown Hilton where the conference was being held and heard an arresting discussion of what scientists knew they didnt know."
