Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.
All of it. I'm still waiting for you to show me how information in the DNA code can increase....as well as how mutations have the ability to add up.What part of evolution is not governed by physical laws?
You seem to be conflating the fact of evolution with the theory of evolution. The evidence supporting the theory of evolution more than shows that it is a fact.I've mentioned before evolutionism isn't a fact. For you to suggest it is would be an error on your part.
There is nothing that would cause the information in DNA code to increase to what we see today. Codes require a programmer.
I've mentioned before evolutionism isn't a fact. For you to suggest it is would be an error on your part.
There is nothing that would cause the information in DNA code to increase to what we see today. Codes require a programmer.
Complete bull-feces. What do you mean with 'increase'? Evolution is a fact, there is no doubt about that any more.
I've mentioned before evolutionism isn't a fact.
There is nothing that would cause the information in DNA code to increase to what we see today. Codes require a programmer.
Then explain how the information in the DNA code increases.
It would help if you used proper terminology. You are using a loaded term. Perhaps instead you should ask how new traits are added.Then explain how the information in the DNA code increases.
Evolution is both a theory and a fact, just as gravity is both a theory and a fact.
.
It would help if you used proper terminology. You are using a loaded term. Perhaps instead you should ask how new traits are added.
You have not defined what you mean by "information". You seem to know what a trait is. And we can explain how those are added. By the way, any reasonable definition of "information" will allow it to be increased through the evolutionary process. This is a prediction, but I have not seen a creationist that could both come up with a reasonable definition of information and show that known processes would not increase it.Are you saying a new trait doesn't require an increase of information?
Are you saying a new trait doesn't require an increase of information?
Once again I ask "Are you saying a new trait doesn't require an increase of information?"Since you can't measure information, or even define information, how are we to tell? As I asked before . . .
What is the information content of this DNA sequence:
CAAGTTAAACTGCTGGGGAACCGCGTTTCCACGACCGGTGCACGATTTAATTTCGCCGACGTGACGACATTCCTGCTAATGCCTCACCCGCCGGACCCCTCTCGTGATGGGGTAGCTGGACATGTCCTTGTGAGATATAACAAGAGCCTGCCTGTTTAATGATCTCACGGCGAAAGTCGGGGGGACAGCAGCGGCTGCAGACATTATACCGCAACAACACTAAGGTGAGATAACTCCGTAGTTGACTACGCATTCCTCTAGACCTTACTTGACCGGATACAGTGACTTTGACACGTTTGT
More importantly, which mutations at which bases will increase or decrease that information content?
Once again I ask "Are you saying a new trait doesn't require an increase of information?"
Thr real answer? None. A random blind process can't increase the information to the point a new trait can be coded for.Until you define what information is and how to measure it, I can't answer your question. "Information" is something you invented, so you need to define it. I will ask again.
What is the information content of this DNA sequence:
CAAGTTAAACTGCTGGGGAACCGCGTTTCCACGACCGGTGCACGATTTAATTTCGCCGACGTGACGACATTCCTGCTAATGCCTCACCCGCCGGACCCCTCTCGTGATGGGGTAGCTGGACATGTCCTTGTGAGATATAACAAGAGCCTGCCTGTTTAATGATCTCACGGCGAAAGTCGGGGGGACAGCAGCGGCTGCAGACATTATACCGCAACAACACTAAGGTGAGATAACTCCGTAGTTGACTACGCATTCCTCTAGACCTTACTTGACCGGATACAGTGACTTTGACACGTTTGT
More importantly, which mutations at which bases will increase or decrease that information content?
Thr real answer? None. A random blind process can't increase the information to the point a new trait can be coded for.
How are you quantifying information?Thr real answer? None. A random blind process can't increase the information to the point a new trait can be coded for.
Can't happen.
We use cookies and similar technologies for the following purposes:
Do you accept cookies and these technologies?
We use cookies and similar technologies for the following purposes:
Do you accept cookies and these technologies?