Evoloution is Just Bad Science

[pastorob]

I am new to this forum, but from what I have seen, all of the arguments regarding evoloution are old and tired and frankly, Not even good science.

The latest scientific information regarding DNA, verses Evoloutionary theory, is that under the constraints of Evoloution, DNA, being Digital Code, invalidates all Evoloutionary theory. Since DNA is Coded information about how matter is to be constructed, it is impossible that DNA could occur naturally. All Good Scientists know that Digital Code comes from an intelligent source, not by random selection. Anyway, I have taught this subjest for 20 + years and have over 1,000 hours of lectures on the subject. I look forward to any intelligent interaction with well informed challengers, if you dare!

 

[USincognito]

Howdy Pastorb.

Nice opening salvo there... can't wait to see if your assertions pan out.

I'll offer two bits of commentary though:

1. Evolution =/= atheism.
2. Abiogenesis =/= evolution.

Thanks for your time.

 

[aca_rev55]

I am new to this forum, but from what I have seen, all of the arguments regarding evoloution are old and tired and frankly, Not even good science.

The latest scientific information regarding DNA, verses Evoloutionary theory, is that under the constraints of Evoloution, DNA, being Digital Code, invalidates all Evoloutionary theory. Since DNA is Coded information about how matter is to be constructed, it is impossible that DNA could occur naturally. All Good Scientists know that Digital Code comes from an intelligent source, not by random selection. Anyway, I have taught this subjest for 20 + years and have over 1,000 hours of lectures on the subject. I look forward to any intelligent interaction with well informed challengers, if you dare!

That is wonderfully, just fabulous. I find it fascinating, also, how you've taught about evolutionary flaws for over 20 years and can't spell it right. Or, perhaps, we're all just spelling it wrong. I'm assuming, of course, that all studies pertaining to genetics, biology, astronomy, mathematics, cosmology, geology, chemistry, geochemistry, oceanography, archeology, astrophysics, anatomy, taxonomy, phylogeny etc. are all bad sciences as well? I mean, come on... seriously, what is with all those scientists... the male uterus OBVIOUSLY has a function and is by no means vestigial. Homogenous structures? Yea right, bad science. Chimpanzees' genetic material is 99.4% the same as ours? Pish posh... that's bad science, they're monkeys and besides, they look different than us. Stupid scientists... every one of them millions of scientists are just bad scientists, they've been studying this **** for 100 years and they still just don't know what they are talking about.

And contrary to what some believe, evolution does NOT equal atheism... unless of course, a theistic-evolutionist is the result of some sick oxymoron that makes no sense what so ever.

And since evolution is nothing but bad science... let's see 100% proof that creation is the way to go without using "bad science" like evolutionists use. It's gotta be scientific proof, and you can't use the Bible or any of God's words.

 

[tocis]

DNA, being Digital Code, invalidates all Evoloutionary theory. Since DNA is Coded information about how matter is to be constructed, it is impossible that DNA could occur naturally. All Good Scientists know that Digital Code comes from an intelligent source, not by random selection.

What you really say here is "We know that all digital information created by humans has been created by humans, so there can be no other source for it".

Care to explain why you think DNA can't possibly be a product of natural processes? What natural phenomena or mechanisms make that impossible in your opinion?

For someone who supposedly taught about that subject for many years, you sound surprisingly uninformed. Makes me wonder...

...could it be that creationists sometimes tell lies? *remembers Hovind and Gastrich*

 

[corvus_corax]

Is DNA 0's and 1's?
This is not a sarcastic question
Im really asking because I dont know
Thanks for any insight and sources that demonstrate this

 

[Deamiter]

I look forward to any intelligent interaction with well informed challengers, if you dare!

So far I've seen NO intelligence displayed and no indication that any answers are well informed! Having been around for a while, I know you guys can do better than this!

No need to jump up and down ridiculing creationists -- he's new here for goodness sakes!

Further, he never even implied that evolution=atheism and certainly if it were impossible for digital code to arise naturally, there'd be a serious problem with theories of common descent, if not with observed evolution!

Anyway, to answer corax, no, DNA is not binary. As a physicist who COULD look it up, but is to lazy/tired at the moment, I'll let somebody else go further, but it's not really equivilant to binary computer code used today.

 

[corvus_corax]

Anyway, to answer corax, no, DNA is not binary. As a physicist who COULD look it up, but is to lazy/tired at the moment, I'll let somebody else go further, but it's not really equivilant to binary computer code used today.

So then its not digital?
Or am I barking up the wrong tree?
Thanks for your input BTW

(to me digital=binary as Im a computer layperson with no real knowledge of binary code....html language-what I do- isnt the same thing )

 

[USincognito]

What you really say here is "We know that all digital information created by humans has been created by humans, so there can be no other source for it".

That sort of thinking is a double edged sword. Let me give you an example from radio Astronomy. Currently SETI is scanning the skies for possible radio transmissions by extra-terrestrial civilizations. How might they differentiate between a transmission and random noise? They'll look for a pattern of course. Aha! say the IDers, you mean a pattern is an indication of intelligence sending a signal.. etc.

Well, the problem with that thinking is that nature does produce patterns and in the 60s (IIRC) they thought they'd received a radio transmission from what sounded like a space beacon broadcasting twice a second. Was it a transmission from an intelligence? No, it was just a Pulsar.

Deamiter,

I took this particular phrase, "All Good Scientists know that Digital Code comes from an intelligent source, not by random selection..." to be an allusion to evolution = atheism. I guess you read it differently.

 

[Douglaangu v2.0]

Anyway, I have taught this subjest for 20 + years and have over 1,000 hours of lectures on the subject.

What are your qualifications? Have you been teaching at a respected university? Have you published any scientific papers? Written any books?

 

[Kripost]

I am new to this forum, but from what I have seen, all of the arguments regarding evoloution are old and tired and frankly, Not even good science.

The latest scientific information regarding DNA, verses Evoloutionary theory, is that under the constraints of Evoloution, DNA, being Digital Code, invalidates all Evoloutionary theory. Since DNA is Coded information about how matter is to be constructed, it is impossible that DNA could occur naturally. All Good Scientists know that Digital Code comes from an intelligent source, not by random selection. Anyway, I have taught this subjest for 20 + years and have over 1,000 hours of lectures on the subject. I look forward to any intelligent interaction with well informed challengers, if you dare!

DNA is not digital code. DNA are crealy organic chemical compounds. Although DNA can be represented digitally, it is no different in representing english words digitally, except that DNA requires fewer 'alphabets' to be represented.

 

[mikeynov]

I am new to this forum, but from what I have seen, all of the arguments regarding evoloution are old and tired and frankly, Not even good science.

The latest scientific information regarding DNA, verses Evoloutionary theory, is that under the constraints of Evoloution, DNA, being Digital Code, invalidates all Evoloutionary theory. Since DNA is Coded information about how matter is to be constructed, it is impossible that DNA could occur naturally. All Good Scientists know that Digital Code comes from an intelligent source, not by random selection. Anyway, I have taught this subjest for 20 + years and have over 1,000 hours of lectures on the subject. I look forward to any intelligent interaction with well informed challengers, if you dare!

I agree. Whatever "evoloutionary theory" is, it's probably based on misunderstanding

 

[raphael_aa]

The latest scientific information regarding DNA, verses Evoloutionary theory, is that under the constraints of Evoloution, DNA, being Digital Code, invalidates all Evoloutionary theory. Since DNA is Coded information about how matter is to be constructed, it is impossible that DNA could occur naturally. All Good Scientists know that Digital Code comes from an intelligent source, not by random selection.

citation rather than assertion please ... preferably from a 'good' scientist.

 

[corvus_corax]

DNA is not digital code. DNA are crealy organic chemical compounds. Although DNA can be represented digitally, it is no different in representing english words digitally, except that DNA requires fewer 'alphabets' to be represented.

So for my clarification....
DNA can be expressed digitally, but is (in and of itself) not digital.
Well doesnt that throw the entire OP in disarray?

 

[Kripost]

So for my clarification....
DNA can be expressed digitally, but is (in and of itself) not digital.
Well doesnt that throw the entire OP in disarray?

Yes. That was exactly what I am trying to say.

 

[Phred]

I am new to this forum, but from what I have seen, all of the arguments regarding evoloution are old and tired and frankly, Not even good science.

I'm concerned that you don't know how to spell it yet feel qualified to challenge it.

The latest scientific information regarding DNA, verses Evoloutionary theory, is that under the constraints of Evoloution, DNA, being Digital Code, invalidates all Evoloutionary theory.

That's simply bearing false witness. Evolution is defined as: a change in the gene pool of a population over time. A gene is a hereditary unit that can be passed on unaltered for many generations. The gene pool is the set of all genes in a species or population. Now, DNA has two types of digital information - the genes that encode proteins, which are the molecular machines of life, and the gene regulatory networks that specify the behavior of the genes. Neither of these inhibits evolution in any way.

Since DNA is Coded information about how matter is to be constructed, it is impossible that DNA could occur naturally.

DNA is not coded information about how MATTER is constructed. This, again, is false witness. DNA is the coded information about how a biologic entity is "constructed". The statement that DNA cannot occur naturally is based upon incorrect assumptions. Many of which you've put on display here.

All Good Scientists know that Digital Code comes from an intelligent source, not by random selection.

This too is false. The category "all good scientists"... that's false. It's just your way of saying, "all who agree with me and call themselves scientists." Digital code doesn't have to come from an intelligent source. Ever hear of a lightning bug? A firefly? How about a snowflake? Lastly, what is "random selection"? Do you mean natural selection?

Anyway, I have taught this subjest for 20 + years and have over 1,000 hours of lectures on the subject. I look forward to any intelligent interaction with well informed challengers, if you dare!

What subject? Have you taught disinformation for 20 years? Am I to somehow be impressed that you could find audiences to listen to you mangle science for over a thousand hours? I see your name contains "pastor"... have you presented this disinformation to a flock for over 20 years?

That's terrible.

.
​

 

[HRE]

Is DNA 0's and 1's?
This is not a sarcastic question
Im really asking because I dont know
Thanks for any insight and sources that demonstrate this

Perhaps I can give you a more detailed explanation.

DNA is made of four different nucleotides: Adenine, Guanine, Cytosine, and Thymine -- abreviated A, G, C, and T.

Now, imagine that we have a strand of DNA, something like:

ACGTACAACGATCGTAACGATTCTAGTATTCTA

It will also have a second, complimentary strand attached to it. A is complimentary to T, and C to G. So it would look something like:

TGCATGTTGCTAGCATTGCTAAGATCATAAGAT
ACGTACAACGATCGTAACGATTCTAGTATTCTA

Now, this is good and well, but it simply doesn't do anything. To make anything out of DNA, first we have to turn part of it (the part that holds the info we need) into RNA. Now, RNA has a different nucleotide called Uracil in place of Thymine, and it will form a complementary piece to the bit we want to copy:

TGCATGTTGCTAGCATTGCTAAGATCATAAGAT
----AUGUUGCUAGCAUUGCUAAGAUCAUAA----
ACGTACAACGATCGTAACGATTCTAGTATTCTA

(- For spacing and formatting; not in actual DNA)

Now, our RNA strand is going to get made into an amino acid chain. RNA is read in a series of three nucleotides, called triplets. They are also known as codons. Now, if you think about it, if you have three nucleotides that can be one of the four nucleotides, then you can have 4^3 arrangements, or 64 different sequences of three nucleotides. Since we only have 20 amino acids, some code for the same amino acid. Maybe an illustration will be better.

Our RNA strand:

AUGUUGCUAGCAUUGCUAAGAUCAUAA

Divided into triplets:

AUG | UUG | CUA | GCA | UUG | CUA | AGA | UCA | UAA

I can figure out which amino acid each codes for using a table like this:

Since my first nucleotide is A, I go down to the third major row (look at the right side). My second nucleotide is U, so I can stay in the first column (top). Finally, my last nucleotide is G, so I need to go to the fourth minor row. See, my amino acid is met (methianine) in the fourth minor row of the third major row and in the first column.

There is a reason I put AUG as the beginning of my gene. It is known as a start codon, because it is always required to be the first amino acid in an amino acid chain.

So, the cell will read the AUG and get a methianine. It will then read UUG and get a leusine (fourth minor row in the first major row under the first column). It will attach the leucine to the methianine, and then read the next triplet, until I have:

AUG | UUG | CUA | GCA | UUG | CUA | AGA | UCA | UAA

MET | LEU | LEU | ALA | LEU | LEU | ARG | SER | Stop

The UAA at the end is called a stop codon -- it doesn't code for anything, so when it is read, the amino acid chain is read. The technical term for the finished chain is a polypeptide chain. Expanded, it looks like this:

Methianine - Leucine - Leucine - Alanin - Leucine - Leucine - Arginine - Serine

Now, this doesn't do anything for us yet. First, our chain will be folded twisted, and combined in a series of folding levels: Primary, Secondary, Tertiary, and Quaternary.

The primary level is the simple amino acid chain.

The secondary level is where the chain is either folded like a fan (called a beta-pleated sheet) or spiralled, like DNA (called an alpha helix).

In the tertiary level, many sheets and helices will come together to form a protein subunit -- simply a part of the protien that does something.

Finally, in the quaternary level, many subunits come together to form a full, working protein.

And that is it. We have gone from DNA to protein, and proteins will do all the work in the body: making cells, sending chemical -- they do it all.

For the experts -- I know this isn't all of it. I didn't go into mRNA, tRNA, exons, introns, splicing, 3', 5', and so forth and so on...but hey, I'm not being paid to teach an intro to biology class, now am I?

 

[GoSeminoles!]

I am new to this forum, but from what I have seen, all of the arguments regarding evoloution are old and tired and frankly, Not even good science.

The latest scientific information regarding DNA, verses Evoloutionary theory, is that under the constraints of Evoloution, DNA, being Digital Code, invalidates all Evoloutionary theory. Since DNA is Coded information about how matter is to be constructed, it is impossible that DNA could occur naturally. All Good Scientists know that Digital Code comes from an intelligent source, not by random selection. Anyway, I have taught this subjest for 20 + years and have over 1,000 hours of lectures on the subject. I look forward to any intelligent interaction with well informed challengers, if you dare!

With all due respect pastor, stick to spiritual matters and leave science to the professionals.

 

[tryptophan]

I am new to this forum, but from what I have seen, all of the arguments regarding evoloution are old and tired and frankly, Not even good science.

The latest scientific information regarding DNA, verses Evoloutionary theory, is that under the constraints of Evoloution, DNA, being Digital Code, invalidates all Evoloutionary theory. Since DNA is Coded information about how matter is to be constructed, it is impossible that DNA could occur naturally. All Good Scientists know that Digital Code comes from an intelligent source, not by random selection. Anyway, I have taught this subjest for 20 + years and have over 1,000 hours of lectures on the subject. I look forward to any intelligent interaction with well informed challengers, if you dare!

Welcome to the forum. You said that you have taught this subject. Do you mean science in general, or just evolution?

I will respectfully disagree with your statement. Of course it is true that digital code only comes from an intelligent source. However, we have to be careful about looking at man-made products and concluding that they also apply to the natural world. Unless you have some scientific sources that show that it is indeed impossible, I think that it could happen naturally (although I believe that God had a hand in it).

 

[rmwilliamsll]

DNA is not digital code. DNA are crealy organic chemical compounds. Although DNA can be represented digitally, it is no different in representing english words digitally, except that DNA requires fewer 'alphabets' to be represented.

i think you miss his point.
digital vs analogy representation of information----
digital means to partition into two catagories
analogy means this partition is impossible because of a range of intermediate (between the two extremes) values.

The digital river is the major metaphor of Dawkins _Out of Eden_, and they are right, DNA can be expressed easily as a digital pattern.

the big scientific issue in understanding that DNA is digital is that the blending of characteristics that Darwin was so concerned with is not commonly the case.

actually when i first encountered Turning machines, i thought in terms of DNA, i studied biology before computer science.

on another posting:

20 years and can't spell it right. Or, perhaps, we're all just spelling it wrong

please be careful criticizing grammar, structure or spelling for this is an international community and there are those here who are operating in a 2nd or 3rd etc language. even typing in English can be difficult for people using a different character set. Certainly we can and do make judgements based on these criteria, but unless further information is forthcoming, extreme sensitivity to these issues is warranted. of course, imho.

 

[Event Horizon]

The forum seems like it's flooded with newbie creationists everyday who say they have all the answers and know everything about evolution (including the "flaws" in it) even though half can't even spell it. Get ready for some more PRATT spouting... again and then tomorrow new ones will come and do the same.