Search results

While C&E isn't the venue for such things... it did get me thinking. Apparently, it's really really hard to figure out dates and time spans using biblical literature. It's interesting because so much of the creation belief stems from a time span derived from biblical literature. I mean...

1. The overwhelming breadth of physical evidence supporting the theory of evolution as an accurate description of how all life came to be as it is today. 2. Aside from supernatural assertions put forth by ancient fractured theisms written down by men of antiquity, there is no compelling reason...

I'm trying to get to the bottom of this and find out why this debate almost never makes progress. Thanks to a few theists that have actually seen discussions through long enough for me to gain some insight into their thought process, I think that I'm getting closer to the root cause for the...

Unlike the "debate" over creation vs. evolution and the origin of man, science has no stance as to the origin of the universe or even if the universe has an origin at all. Like creationism, belief in some supernatural entity just to explain a thing we have no knowledge of, is simply god of the...

Just because you have been raised to believe something without valid reason doesn't mean that your belief should be the default. If you want anyone to share your belief then you should be able to give valid reason for doing so. It's time to call an ace an ace and label this so-called "debate"...

I have stated on a number of occasions that, to me at least, belief is something that is earned. If you have a compelling argument based on sound reasoning for your belief then you will have earned the right to hold that belief. When I started posting here two years ago one of my first threads...

While the standard modus operandi for this forum is for creationists to claim that the Theory of Evolution is not true and demand that the proponents of evolution provide them irrefutable proof of its validity, I would like to change it around this time. If the standard is so high for a...

Those of you who have been involved in this debate for a reasonable length of time have come to realize that while the evidence supporting evolution is overwhelming fundamentalists have all drawn a proverbial line in the sand at the biblical “kind”. They all stand behind this line and boldly...

From: http://www.theglobeandmail.com/servlet/story/RTGAM.20061201.wxmeteorite01/BNStory/Science/home

From: http://www.physorg.com/news83410847.html

From: http://www.cnn.com/2006/US/11/17/ape.alarm.ap/index.html Those stupid animals. I don't see how anyone can think we share a common ancestor. ;)

From: The New York Times

From: http://www.medicalnewstoday.com/medicalnews.php?newsid=55803

Another one of my favorite lines of evidence for its sheer simplicity is human chromosome two. Human chromosome two is an exact copy of two ape chromosomes fused together. When we line up the chromosomes it becomes apparent from the banding. Additionally, chromosomes end in telomeres and...

Here is a genetic sequence from an organism with a working GULO gene: GAGAAGACCAAGGAGGCCCTACTGGAGCTAAAGGCCATGCTGGAGGCCCACCCCAAAGTGGTAGCCCACTACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCCTGCTTCCAGAGGGACAGCTGCTACATGAACATCATTATGTAC [Rat GULO (Exon10)] Below are four genetic sequences from...

During my time here I’ve seen that pretty much every creationist has accepted what they call “micro”evolution. They accept that mutations happen and talk about divergence. Here is a quote from a recent debate: Using Mark as an example, the creationist accepts that genetic evidence shows us...

Anyone else notice that in spite of all of their rhetoric creationists are constantly trying to elevate creationism by conflating it with science while trying to insult science by conflating it with religion. In contrast, it’s obvious that scientists want to distance themselves from creationism...

From: http://news.mongabay.com/2006/1023-orangutans.html

From: http://www.theage.com.au/news/national/fossil-fish-nets-new-evolution-theory/2006/10/19/1160851067512.html Gogonasus is on display at the Melbourne Museum until November 19. www.museum.vic.gov.au

I’d like to take a moment to ask you all to welcome one of my best friends in the world TheCommonPatriot. TCP is a creationist (see… I wasn’t lying when I said one of my best friends is a creationist) who has signed up at my request to help mellow the tension around here and, IMHO, serve as a...