The Blind Atheist: The Unscientific Root of Atheism

[RFHendrix]

Hi everyone.

I did not see a discussion on origins on this board so I thought I would start one. Here is an excerpt from my new book about the idea that DNA or RNA in a supposed "world" could somehow self-organize it self into meaningful coded communication that must exiist before life can come into being.

From the chapter;

The Foundation of All Life is the Written Word:

...Let’s say there is a pile of plastic letters lying around outside. The wind blows these millions of letters around for millions of years and eventually we come on the scene and look the situation over. After searching through the confusion we eventually find a complete sentence spelled out that says, "Give this information to the DNA." Now remember, we are a distant observer looking at things like they were in the beginning before there was life, so let’s not interject ourselves into this situation. What would a creature with no mind do with that "information?" There is no information there because there are no instructions that can be read and interpreted. No one knows what any of it means. That sentence may as well be any other random jumble of letters. It only makes sense to us, but remember we are not supposed to be there. So the question is, who or what makes sense of it? How can anyone or anything follow these so called instructions?

Who says that a G means one thing and a U means another? Who or what decides that letters lined up to form "Give" mean anything at all? Please step back now; These questions are not for you. They are for the mindless matter and energy to figure out. What good are the letters anyway? Are they of any use at all without a mind? Why would one mindless-wonder read the order put down by another mindlesswonder? It is confusion to both. What seems so plain to us is utter confusion to that which has no mind. The DNA code came from somewhere. Where? Who decided that a T should attract an A? Who or what decided that it should be translated and interpreted using one grammatical method and not another? What possible good could it do if the code was not understood and translated correctly? How could even one letter in the DNA code have any significance whatsoever without a value judgement being made?

The reason the computer cannot design something on its own is because of value judgements that must be entered into the system by someone who can discern values. In other words, why is a word better than a letter? Or, why is a sentence better than a word? It seems like the word would be better at first glance because it is much more brief. Someone has to decide if the brevity is better or the more complete explanation is better. Is a tube better if it is porous and allows some of the liquid to seep through or is it better if it contains the liquid completely? Is a low electrical current better than a higher one? Is an image better than text or is text better?

The answers to the above questions may vary even within the same system. Who or what makes these decisions? In the case of a computer we can simply program it to select the color red each time it comes across it. After we do that the computer will do the work for us, seemingly making the value judgements, but we all know who is behind it don’t we? The ultimate conclusion that must be drawn is that an intelligent source is behind the design regardless of what the automatic system is able to do on its own. No one seriously thinks that by turning on a switch a complicated machine comes into existence and operates without the benefit of a designer somewhere along the line.

Let’s say that all the chemicals formed magically out of stuff lying around the earth and a string of DNA formed. Now what? Are there any instructions there? Remember, I am not talking to you. What is that string of DNA except a disordered mass of confusion of no use whatsoever in telling anything or anyone what to do. It can be a string of DNA a mile long that formed itself out of the earth but it is absolutely useless, just as the ladder was that you lettered in a random manner. Now if you had known the code ahead of time, then you could have made some real DNA that gave sensible instructions. Again, YOU could have done that. Play this game however you like, but you will find that all roads lead to intelligent life as the source of information.

You can probably make an interesting language out of snowflakes. I would suggest that you get 26 different ones, start out with an alphabet, and assign different sounds to each one. Then you could devise some type of grammatical rules so that they can be formed into words and sentences. Before you know it you have a language, all from mindless snowflakes. Happy day!

Now let’s move this analogy into the body. RNA, as has been mentioned, copies various pieces of information from DNA and gets the ball rolling so that it can be used in making things. This procedure is quite complicated in real life but I will try to simplify it here. There are plenty of books on the subject and I suggest that anyone who is inclined to pass it all off as a relatively simple thing read up on it first. It is to this day not completely understood how the information in DNA gets transcribed, translated, and then put to work at the appropriate moment. Some parts are now pretty clear as to their inner workings, and some are still a mystery, but it seems like the major components of the cell have at least been identified relative to their usual function. The ribosomes are one part that is still not entirely understood. These are an absolutely essential part and can only be described as information-based machines. There may be thousands of them in each cell and they are made up largely of unique structures of information carrying RNA.

Simply stated, we can say that the RNA follows close behind an ordered chemical reaction that directs the DNA to open itself like a zipper does. The mRNA (messenger RNA) then obtains a copy of relevant portions of the information. The relevant portion, and how that is determined is another area that is not completely understood although we already know that there are coded messages ordering the process to stop and start. Of course there are start and stop messages all through the code so there is still uncertainty as to how it all works. There is even a mechanism which double checks the copies to make sure that they are accurate.

Precisely timed release of certain chemicals causes the RNA to be cut at just the right places. In other parts of the cell these pieces are sometimes spliced back together or formed with precisely made proteins into other components. Those components help in the translation of the code that is interpreted by biological machines by way of other coded instructions into the actual work of making proteins. These unique proteins and enzymes are manufactured according to the strict instructions from a selection of 20 amino acids which themselves provide an endless possibility of combinations similar to the possibilities contained in the English alphabet. Nothing is possible without the information. The cell can do nothing without it except die. All of the processes in the cell are interdependent with each other and they all depend on the information and the precise instructions given by the DNA and by other means.

The cell is like a machine of life. Parts of the machine can be altered and it will still work to some extent, and people can purposely change some of the information in the DNA but the point is that there must be some logic to it. It definitely is not just a mindless code that can be ordered randomly. And it certainly is not just a disordered jumble of proteins that simply react according to the laws of thermodynamics. They do of course react precisely according to those laws but only as they are shielded and directed in those chemical reactions by the unique order dictated by the information. In other words, the proteins that are manufactured are not allowed to simply float about looking for a function or a random chemical reaction to engage in anymore than an automatic transmission is simply a box full of gears that are randomly thrown into a metal case...

 

[Zadok001]

Shows a complete lack of knowledge regarding the basic mechanisms of evolution. I'll let someone better versed in biology deal with this on a large scale, but for now:

Evolutionism != Atheism.

 

[notto]

First problem:
Chemical reactions are not random and your reasoning seems to depend on your assertion that somebody somewhere is saying that they are.

Second problem:
There may be more than one single solution to the originl of "life". You seem to be suggesting that there is only one.

Third problem:
You don't address more primative versions of the same process that more complicated versions of the process could arise from. There are reduced and simplified versions of the reactions and mechanisms that you discuss that can be seen in the natural world.

Your whole argument seems to be one of "if you don't understand it, God did it". Not sure how this illogical reasoning leads to a conclusion that non-intelligent design through selection algorithims (which can also be demonstrated) leads to the conclusion you assert in the title of your thread.

You state that DNA is "certainly is not just a disordered jumble of proteins that simply react according to the laws of thermodynamics". Can you point us to anbody who says that it is? This would be a strawman.

 

[RFHendrix]

Of course the problem is the origin of meaningful information such as exists in the genome of all life. This is no "strawman". This is a problem that actually exists.

And my "whole argument" is in the whole book. I though I made it clear that I was only posting an excerpt.

 

[notto]

Of course the problem is the origin of meaningful information such as exists in the genome of all life. This is no "strawman". This is a problem that actually exists.

Your wording suggests that those that do not accept ID as a valid scientific framework are somehow proposing that the process is random. This is not the case. The language you use, although it is flowery, does nothing to futher your argument because you are stating things that all positions agree on, that the reactions and mechanisms involved are not random.

What would falsify your conclusions?

1) unintelligent algorithims that cause design. (these exist)
2) simplified mechansims that have the same results (these exist)
3) finding multiple solutions that can accomplish the same thing (undetermined so therefore you can't conclude that the way things happen is the only way things happen).

Do you agree or disagree? If you disagree, then what do you propose would falsify your conclusions? Are they falsifyable? How?

 

[RFHendrix]

Here is another excerpt that may help to explain the problem further:

"The debate over the earliest biological molecules, however, has centered mainly on the nucleic acids, DNA and RNA, and the proteins."

The reason that the debate has centered on DNA, RNA and proteins is because they are essential parts of the finished product and these parts seem to be capable of various partly overlapping functions. The main feature of all of these mentioned biological molecules is that they contain information that is necessary for the operation of life (however primitive that life is assumed to be). All of life including bacterial life is based upon information. If we remove the information then life stops. Mr. de Duve is led to believe, as are many others in this field, that the biological molecule RNA must have been one of the first, or the first, molecule formed from the dust of the earth (if I may wax poetic for a moment). So let’s begin exploring this subject of information by using some more quotes from the paper by Christian de Duve.

"They [proteins] cannot do this [replicate themselves] without the information contained in... DNA and RNA".

For our purposes here we will call RNA simply a copy of DNA. Because we are discussing information we should have no problem in assuming that generality for now. So the absolutely essential proteins are dependant on the information contained in RNA. Proteins cannot make themselves into other proteins without a support mechanism that is based upon information.

"The DNA contains in encrypted form the instructions for making proteins."

Again we will assume that RNA does the same thing so that we do not lose track of the problem. He eventually leads us to the conclusion that RNA can serve as a theoretical intermediary by making proteins and DNA so lets assume that he is correct and go on.

"More specifically, encoded within the DNA is the exact order of amino acids, selected at each step from 20 different varieties, should be strung together to form all of the organism’s proteins."

This is simple biology. Let’s put it in other words: DNA and its copy RNA has a code which is translated into another code within the cell (by tRNA and biological machines called ribosomes, etc.) into useful proteins which because of the specific order of their construction contain a record of this information. The key word is information.

"In order for DNA to fulfill its primary role of directing the construction of proteins..."

The "direction" of course is done by way of the instructions and information contained in DNA and RNA - and by extremely relevant other means that will be discussed in later chapters.

"Once the chemical machinery for protein synthesis was installed, information could enter the system, via interactions among certain RNA components of the machinery."

What all of this means is that de Duve (along with many similar theorists) is proposing the following:

The specific detailed instructions that are necessary for the operation of the machinery of the cell in all of its complexity (which we have not touched here) arose by natural means without the intervention or aid of an intelligent source. He is seriously suggesting that established laws of science are not to be considered at all. Nowhere in his paper does he hint at any problem with regard to this information arising by natural means. He is entirely consumed with a series of chemical reactions that completely ignore the very foundation of life.

--------------------------------------------

In other words: How did the genetic code arise along with it's translation and practical use? For example, how were the triplets (codons) defined and given meaning so that the specific codons were translated correctly in order to make functioning biological machinery such as is contained in all life?

 

[notto]

In other words: How did the genetic code arise along with it's translation and practical use? For example, how were the triplets (codons) defined and given meaning so that the specific codons were translated correctly in order to make functioning biological machinery such as is contained in all life?

Intellectually honest scientists may answer "I don't know". If falls far outside of scientific study to answer "God did it".

Showing lack of evidence for another argument does not support your argument.

There is no "meaning" in the codons. They follow simple chemical laws and reactions. Not all of the possible reactions you discuss have the same likelyhood of occuring. It is not random, and probability dictates which ones are more likely than the other (and wouldn't you know it, these are the ones that occur). If they followed another set of reactions, or if we look at other reactions, they don't work. Basically you are asking "Why does the solution that works work and the ones that don't don't". Not highly informative or predictive.

If a self replicator didn't replicate, it wouldn't be a self replicator, would it?

Again, what would falsify your conclusions? If your argument is scientifically valid and you want it to be addressed as such, you need to be able answer this question.

 

[RFHendrix]

There certainly is a meaning in the codons. Of course they follow simple laws but a codon has no chemical law compelling it to have meaning when divided (effectively) into code which means a specified thing to the machinery that translates it.

If one wished to falsify my conclusion then he can do the following:

The foundation of all life is contained in specific detailed instructions and information that can be read, interpreted, understood and acted upon logically. This type of information cannot arise without intelligent input. Let’s spell out the problem and the proposed solution so that the skeptic can experiment on his own to prove me wrong. DNA and/or RNA gives specific instructions that are in some ways similar to the instructions that a worker might follow as he builds and operates a machine. I will write some instructions which are similar to a fraction of one percent of the instructions contained in a simple, single celled organism and then I will present the problem.

“The completed organism is to be simply one cell. First assemble the RNA molecule so that the ribosomes can interpret the completed instructions. Next begin making the various amino acids. Then arrange them in such a way that they form useful proteins. After those steps are completed then devise a system whereby the RNA can cut itself into pieces. Devise a means whereby these pieces only use the specific information that is needed at a particular time. Now take those pieces of information and splice them together at various times as needed within the cell. Devise a way whereby the ribosomes can come into existence to process the information that is initially necessary for their existence. Finally, cause all of the appropriate parts of the cell to form themselves and replicate themselves in an orderly fashion so that the initial life is able to make and maintain the parts that are necessary to make and maintain and regulate the parts necessary to make the initial parts and the associated machinery that is necessary to make the parts initially out of parts that the initial machines make.”

Now here is the problem. Use any system that you choose, whether it is monkeys typing randomly on billions of typewriters for billions of years, or powerful computers or whatever you want, and produce the above paragraph without intelligent input. Of course a human being will be allowed to set up the experiment but he may not intervene once it is underway. If you use a computer there cannot be a goal entered into the computer and there cannot be value judgements entered into the program because this takes intelligent input and will taint the experiment. The alphabet should be randomly entered into the program along with punctuation marks and spaces but we must stop there as further interference would make the results of our experiment useless in solving the problem. Now run this random program as long as you want on as many computers as you choose and see if the result is ever the above paragraph. Be sure to keep accurate records of each step of the program that you devise so that it can be readily duplicated and tested. That way the public will not be tricked again by intelligent input under the guise of natural processes. After you have solved the problem return to this book and read the following paragraph. NOT NOW!! YOU HAVEN’T SOLVED THE FIRST PROBLEM YET!!

Okay good. Now make the instructions actually do something. Insert the paragraph into another computer and see what it does with the “information.” I think that you will find that even if the complete instructions arose randomly, defying fantastic odds, that it is impossible to use them, without intelligent input. You will need not one miracle but several in order to inform the appropriate parts of the translation mechanism on the meaning and correct use of the words. There is no logical path from the randomly generated “instructions” to actual work without intelligent intervention. Because information is absolutely essential for even the most basic life form there is no logical path to life without the preexistence of an intelligent being.

Now let’s illustrate the problem. We will assume that the basic information is reduced to code. We can take the actual DNA from a living organism to make sure that we get it right. The instructions will look something like this:

AATAACCGCAGGTCTTCAGCCGATATTGACTAGGTC etc. The first problem will be to determine how the code is divided into triplets (codon “words”). Notice that if we start with the first A the first “word” will be AAT. But if the real information should begin with the second A then the first word is ATA. If we begin in the wrong place then all we have is gibberish. For example read one of the sentences that I have written here but ignore the spaces between words. Now remove the first letter and read it. As you can see it is very important that the nascent life form that we are creating knows where the instructions begin and how the actual words are divided correctly into the codon words with a correct understanding of the grammatical structure etc. So how will this first life-form know where to begin? And how will it know to divide the string of DNA into triplets? And how will it know that a triplet is advantageous before it even “knows” what the code is or the other possible alternatives for coding the information?



In real life the codons are divided by a complicated process that effectively uses the information it correctly gathers from the string of DNA. There really is no code without the accompanying translation machinery that discerns the triplets from the endless string of letters. The machinery must exist before the information can exist. And the string of DNA is useless unless it is correctly translated by preexisting translation machinery. The code is manifest by way of specified enzymes that contain information themselves. This information is coordinated with the string of DNA so that the correct three-letter words are used at the correct time and place. So we must not only have the DNA in the exact order but the enzymes used in translation must be in a specified order to correctly manifest the information. I must also say here that these enzymes (with names like tRNA, rRNA, RNA polymerase etc.) must be of the correct shape. Like a puzzle that fits together these information carrying enzymes fit with the appropriate part in the machinery and transfer the information to another part of the machine that is prepared with the appropriate shape and information content to receive it. The code, the shapes, the information and the logistics necessary to coordinate the process and assemble the fragile parts must exist before life can even begin.



So the miracle of life must begin with a string of miracles in order to communicate the code to all of the parts of the translating machinery and in order to ensure that the correct information is used. As you can see the omission or insertion of even one letter in either the DNA or the translation machinery makes the instructions useless. The code itself came from somewhere? Where? The code was communicated to the appropriate parts of the translation machinery so that it knew what it was translating. Who did this? One miracle is not enough. We must have hundreds of miracles coming together at precise times and places in order to even produce the translation of the code!

 

[notto]

Do you understand what falsification is?

Mechanisms within the codon follow simply chemical absolutes. Based on their structure there is no other possible alternative to their behavior then that what we see. There is no "information" that is read, they behave as we would expect them to.

You do not present a method of falsification, you present an absurd strawman of the argument.

You talk about randomness and instruction when discussing the falsification, but there is nothing random about the processes you discuss and there is no need for "instruction" to be given to the parts of the mechanism. They behave as one would expect under purely natural mechanisms.

The way you presented your argument in your last post is easy to falsify. Mutations happen, therefore the mechanisms is not intelligently designed. Mistakes in the transription do NOT make the instruction "totally useless" and can result in new novel functions.

By your argument, each and every chemical reaction we see is "intelligently guided". Just try to keep hydrogen and oxygen from reacting to make water. Because they always react to form water, does that mean that the proper "information " was present and that because of their proper "size and shape" we get water? Is this mechanism intelligently designed?

You discuss the "appropriate shape and 'information content'" as if this is a hindrence to the mechanism. It IS the mechanism. Again, you are simply saying that the chemical reactions that work work. Again, nothing predictive or particularly compelling in that argument.

 

[Arikay]

If anyone is interested our friends book can be found here, http://www.puretolerance.com/

The OP is chapter 6.

 

[RFHendrix]

1. You said: "Mechanisms within the codon follow simply chemical absolutes. Based on their structure there is no other possible alternative to their behavior then that what we see. There is no "information" that is read, they behave as we would expect them to."

Of course it is not disputed that the life process follows chemical absolutes. The quetions are as I articulated them earlier and concern the origin of meaningful information which is the basis for all life. Are you saying that DNA and the associated translation mechanism contains no information?

2. You said: "You do not present a method of falsification, you present an absurd strawman of the argument."

No, I produced a problem that fits with the reality in life as it really exists, i.e., the iinformation problem. Can you solve the problem?

3. You said: " You talk about randomness and instruction when discussing the falsification, but there is nothing random about the processes you discuss and there is no need for "instruction" to be given to the parts of the mechanism. They behave as one would expect under purely natural mechanisms."

Evolution works when there is life. We are talking about the origin of life so how did the code etc. evolve before life evolved (because all life contains coded information)? What exists before life besides the laws of physics? How do you create information and an information processing system using those laws?

4. You said: "The way you presented your argument in your last post is easy to falsify. Mutations happen, therefore the mechanisms is not intelligently designed. Mistakes in the transription do NOT make the instruction "totally useless" and can result in new novel functions."

Again, we are talking about origins, not existing life.

5. You said: "By your argument, each and every chemical reaction we see is "intelligently guided". Just try to keep hydrogen and oxygen from reacting to make water. Because they always react to form water, does that mean that the proper "information " was present and that because of their proper "size and shape" we get water? Is this mechanism intelligently designed?"

Only the origin of the information based system need to be intelligently designed jsut like the rules of grammar that we use requires intelligent intervention. "Shape and size" is a side note which only compounds the problem.

6. You said: "You discuss the "appropriate shape and 'information content'" as if this is a hindrence to the mechanism. It IS the mechanism. Again, you are simply saying that the chemical reactions that work work. Again, nothing predictive or particularly compelling in that argument."

It is compelling if you understand it. The subject is the origin of an information-based interactive system such as actually exists in all of life.

 

[Arikay]

Ah, you hit it on the head, Laws of Physics. The laws of physics would be the creator.

As far as how you create with those laws, you have the right chemicals form together to get self replicating group of chemicals. From there the group slowly gets more complicated.

Im curious though, what does this have to do with atheism?

 

[RFHendrix]

Atheism is revelant because the currently available evidence points to an intelligent creator not the blind laws of physics.

 

[ObbiQuiet]

Atheism is revelant because the currently available evidence points to an intelligent creator not the blind laws of physics.

Or multiple creators...

 

[Arikay]

ah, thats what I figured.

This is called an "argument from ignorance"

Basically you are saying that you do not believe abiogenesis is possible, and thus, an inteligent creator must have done it.

The flaws in that are that each theory must stand or fall on its own. If we were to falsify abiogenesis, you may view it as leaving an Inteligent creator as our best current theory, however, without any evidence, it is not proven to be true because it needs to be able to stand on its own.

Say I close my eyes and pick up a random colored stick from a pile of a bunch of different colors, now say I get the feeling that it is either red or blue. I then somehow deduce that it can not be red. Does that make it blue?

Now, we see that you are working with a strawman version of abiogenesis, and thus, falsifying the strawman will do nothing to the real set of theories.

It also might be of note that abiogenesis isnt as strong as many other theories, like evolution, and has quite a ways to go in many areas.

 

[RFHendrix]

No my argument is based upon available evidence and the knowledge of where that evidence leads. I can just as easily say that abiogenesis is based an argument from ignorance. Here is the basis for my argument:

1. DNA contains information and the source of that information is unknown. Life is known to be a biological information based machine.

2. There exists in the world an intelligent source of information, i.e the human mind. This has been empirically proved and confirmed in several thousand years of human history and experimentation. There has never been even one verified example where information or intricate interactive machinery came into being without intelligent input.



Speculation: Perhaps the information within DNA and the associated machinery of life came into being by way of the laws of physics? Or perhaps there is an intelligent source of information within the universe?



Because there is no known instance where information or intricate interactive machinery arose by way of the laws of physics that hypothesis is entirely speculation without any empirical basis whatsoever. On the other hand, it has already been proved that information and machinery comes into being by way of an invisible intelligent mental source that uses the laws of physics as tools to manifest that reality.



Conclusion: Belief in an intelligent mental source within the universe is a rational deduction based upon facts and evidence.

 

[RFHendrix]

Or multiple creators...

The genetic code is almost universal (there are a few exceptions which appear to be recent variations). The evidence point to ONE creator, not several. Otherwise the entire theory of evolution is not valid either because Darwinists use the same facts to prove all life evolved from a single simple life form.

 

[Arikay]

May I recomend using the real version of abiogenesis and not the strawman.
Here is a short read on abiogenesis, http://www.talkorigins.org/faqs/abioprob/abioprob.html

So, you have evidence for this inteligent designer? This evidence is more than "abiogenesis is false, thus an inteligent designer must have done it"?

No my argument is based upon available evidence and the knowledge of where that evidence leads. I can just as easily say that abiogenesis is based an argument from ignorance. Here is the basis for my argument:

1. DNA contains information and the source of that information is unknown. Life is known to be a biological information based machine.

2. There exists in the world an intelligent source of information, i.e the human mind. This has been empirically proved and confirmed in several thousand years of human history and experimentation. There has never been even one verified example where information or intricate interactive machinery came into being without intelligent input.



Speculation: Perhaps the information within DNA and the associated machinery of life came into being by way of the laws of physics? Or perhaps there is an intelligent source of information within the universe?



Because there is no known instance where information or intricate interactive machinery arose by way of the laws of physics that hypothesis is entirely speculation without any empirical basis whatsoever. On the other hand, it has already been proved that information and machinery comes into being by way of an invisible intelligent mental source that uses the laws of physics as tools to manifest that reality.



Conclusion: Belief in an intelligent mental source within the universe is a rational deduction based upon facts and evidence.

 

[Arikay]

your making assumption apon assumption and believing them as fact.

1) What if the multiple creators had a meeting and decided on a specific design? You can not rule out multiple creators, when dealing with inteligent design, since you can not even test for or falsify a single omnipotent creature, let alone many, nor can you make assumption on how these omnipotent creatures would act.

2) It would have no effect on the theory of evolution, and darwinist is an old outdated term.

The genetic code is almost universal (there are a few exceptions which appear to be recent variations). The evidence point to ONE creator, not several. Otherwise the entire theory of evolution is not valid either because Darwinists use the same facts to prove all life evolved from a single simple life form.

 

[RFHendrix]

May I recomend using the real version of abiogenesis and not the strawman.
Here is a short read on abiogenesis, [link deleted]
So, you have evidence for this inteligent designer? This evidence is more than "abiogenesis is false, thus an inteligent designer must have done it"?

Thanks for the link. I have read that article before but it does not discuss what is being discussed here. The origin of the coded instructiions along with the formation of a grammatical system, code etc. is the primary problem. Because all life is based on interactive information-based machinery that revolves around coded communication, the article only scratches the surface of the real problem and certanly does not answer the questions I posed here.