TLK Valentine
I've already read the books you want burned.
- Apr 15, 2012
- 64,493
- 30,323
- Country
- United States
- Gender
- Male
- Faith
- Agnostic
- Marital Status
- Single
Upvote
0
Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.
So, if I get this right....you are saying there is no information contained in DNA? Yes?
I neither said that or even implied that. And since you can't define the term "information" I cannot even answer that question.
You are not a newbie here. You must know the basic rules of debate by now.
That does not mean that natural selection is debatable. All it reflects is that fact that where a mutation is beneficial or not is dependent on the environment that it occurs in. It seems that you do not even know the basics of what you are trying to argue against. If you don't understand the theory of evolution you will have a very difficult time refuting it.
Like any word it has multiple definitions. You have not said which definition that you are using. Once again, I am betting that any reasonable definition of the word "information" that you use will not contradict the theory of evolution in any way at all.I think you know very well what information is. I also realize how ever I present it you will have to disagree. Information is seen in many forms. Letters on a page of a book. Dots and dashes. Ones and zeros.
Please don't try to ask "gotcha questions". It only shows your terrible ignorance. It is also not very honest.Are you saying the environment can't be random? It's always predictable?
Please don't try to ask "gotcha questions". It only shows your terrible ignorance. It is also not very honest.
And once again, I did not say that or even imply that.
Like any word it has multiple definitions. You have not said which definition that you are using. Once again, I am betting that any reasonable definition of the word "information" that you use will not contradict the theory of evolution in any way at all.
Are you afraid to live up to your obligation?
You're reading information.
Infomation is derived from intelligence. Such as the information contained in a code. Intelligence is required to write the code and intelligence is required to decipher the code.
I'll admit DNA doesn't have WiFi...but it can copy itself, pass that portion of code along...read the code and complete the instructions. Sounds like information being used to me.Information is words on the Internet. Got it.
Of course, I don't think DNA has WiFi, so I don't see how it could have any information by that definition.
Perhaps you could give a definition... at long last?
For the most part....though I'm sure you could think of some off the wall source then pass it off as normal.Is that the definition of information you're going with? Anything derived from intelligence?
Yes, you're right....the mutations know exactly where to occur. Nothing random.
I'll admit DNA doesn't have WiFi...but it can copy itself,
pass that portion of code along...read the code and complete the instructions.
Sounds like information being used to me.
It was a simple and serious question.
Information has several forms...but you already knew that....and for some reason are trying to disprove that. Information is instruction.No it can't. Proteins and RNA copy DNA.
Also, you claim that your post on an internet forum is information, yet that post can not copy itself. So how can it be information?
None of these properties are found in your internet posts. Does this mean that your internet posts do not contain information?
Every single particle of matter contains information.
"In physics, physical information refers generally to the information that is contained in a physical system. Its usage in quantum mechanics (i.e. quantum information) is important, for example in the concept of quantum entanglement to describe effectively direct or causal relationships between apparently distinct or spatially separated particles.
Information itself may be loosely defined as "that which can distinguish one thing from another".[citation needed] The information embodied by a thing can thus be said to be the identity of the particular thing itself, that is, all of its properties, all that makes it distinct from other (real or potential) things. It is a complete description of the thing, but in a sense that is divorced from any particular language."
https://en.wikipedia.org/wiki/Physical_information
A rock contains information. A water molecule contains information. An electron contains information.
What is the information above? Who knows. You could have simply just typed random variations of CATG....in which case there is no instruction or useful information. Then again you may have copied it from some where.So was mine.
What is the information content of this DNA sequence:
CAAGTTAAACTGCTGGGGAACCGCGTTTCCACGACCGGTGCACGATTTAATTTCGCCGACGTGACGACATTCCTGCTAATGCCTCACCCGCCGGACCCCTCTCGTGATGGGGTAGCTGGACATGTCCTTGTGAGATATAACAAGAGCCTGCCTGTTTAATGATCTCACGGCGAAAGTCGGGGGGACAGCAGCGGCTGCAGACATTATACCGCAACAACACTAAGGTGAGATAACTCCGTAGTTGACTACGCATTCCTCTAGACCTTACTTGACCGGATACAGTGACTTTGACACGTTTGT
Show us how you measure the information in that DNA sequence, and show how no mutation can increase the information in that DNA sequence.
If you can't answer this question, then it is you who has confirmed that DNA does not contain the type of information you claim is there.
Information has several forms...but you already knew that....and for some reason are trying to disprove that. Information is instruction.
- Yes, proteins and RNA copy the DNA. What you fail to realize is that it is the code in the DNA that instructs the components in the cell on how to assemble the amino acids into proteins...then how to fold the amino acids in such a fashion that they can join with other proteins and form organelle that have the ability to copy the instructions (information) in the DNA. So, yes, the DNA doesn't directly mate with other DNA and have offspring DNA babies....but rather creates machines to do it for itself. The design is rather intelligent.
We use cookies and similar technologies for the following purposes:
Do you accept cookies and these technologies?
We use cookies and similar technologies for the following purposes:
Do you accept cookies and these technologies?