Misdirection in Claim of 97% DNA match in Humans, Chimps

[Loudmouth]

In one of the most extensive studies comparing human and chimp DNA,6 the researchers compared >19.8 million bases.
While this sounds like a lot, it still represents slightly less than 1% of the genome.
Wait wait wait...


They only actually compared less than 1% of the DNA?

It's statements like that which take away all of your credibility. The chimp genome was sequenced 7 years ago, and the numbers they use for their comparisons is from way more than just 20 million bases.

"Here we present a draft genome sequence of the common chimpanzee (Pan troglodytes). Through comparison with the human genome, we have generated a largely complete catalogue of the genetic differences that have accumulated since the human and chimpanzee species diverged from our common ancestor, constituting approximately thirty-five million single-nucleotide changes, five million insertion/deletion events, and various chromosomal rearrangements."
http://www.nature.com/nature/journal/v437/n7055/full/nature04072.html

So 35 million substitutions and 5 million indel events. This means that substitutions are 7 times more common indels, but indels can cover more than one base. This is why you get different numbers because it depends on how you use indels in your calculations. Do you count the number of bases in the indel, or do you count the indel once as a one time event? Do you leave the indels out entirely in order to calculate the substitution rate within DNA shared by both species? There are reasons for doing each comparison, and it has nothing to do with misleading creationists.

 

[Loudmouth]

I will repeat this post in case you missed it:

species A: AATATTTATATT--GGAATTT
species B: AATATTTACATTCTGGAATTT


According to you, how should the scientific community report the similarity between these two species at the DNA level?

 

[Loudmouth]

It means that 96% of the aligned sequence is identical, depending on how you incorporate indels into the calculation.

 

[cf123]

the number of DNA pairs is massive so even a 1% variation can lead to a massive difference.

a 1% difference of billions of codes, is tens of millions of variations.

however with DNA you can work backwards to trace your origins. your DNA is a blueprint of how you were made, your genes had to have come from your ancestors and our genes indicate that we all share a common ancestry with animals.

we dont use DNA to prove evolution.

you work in the opposite direction. when you start with the evidence, the evidence we observe from DNA suggests that some form of evolution has occurred.

 

[Nazaroo]

species A: AATATTTATATT--GGAATTT
species B: AATATTTACATTCTGGAATTT

According to you, how should the scientific community report the similarity between these two species at the DNA level?

According to me, the scientific community should stick strictly to these procedures:


(1) State all findings with accompanying calculations for stated precision, and provide evaluations of accuracy, using properly calculated margins of error, etc.

(2) Make sure all statistical claims are accompanied by statements of expected accuracy of results, as is standard with polls, i.e., "this result is expected to be true in 7 out of 10 statistical samples" etc.

(3) State clearly the limits of all measurements, especially sampling techniques, as in "10% sample of the 6 billion nucleotides were checked, and the findings were extrapolated to the other 90% based on the following theory..."

(4) State clearly the theoretical basis for all empirical claims.

(5) Strictly avoid all ambiguous language in reporting findings. In particular, avoid bumbling amateur mistakes, like confusing "similar" with "identical", and failing to state the mathematical type of "average" that is meant.


If propagandists, apologists, and popularizers of scientific findings followed these rules, you wouldn't have fiascos like this.

 

[OllieFranz]

I would add this 'error', or rather deliberate fraud to the long list of Evolutionist self-delusions, but it deserves its own thread as stunning example
of how propaganda is manufactured for deliberate effect.

The normal use of percentages to express similarity,
even estimates and guesstimates,
does not involve extra layers of sophisticated
misdirection or fakery.

If a man says 'these two objects are 50% the same,
the meaning is transparently clear.
Half the features, components, arrangement, and/or surface
will be essentially identical.

In fact IQ tests abound with such tests,
which require the reader to make the correct interpretation
of a phrase and usage of the percentage sign.

Looking at the picture below, the viewer has no problem
identifying the two meals as 100% identical, except for the plate:

The field of Genetics is no exception to normal English usage,
or at least it shouldn't be, and most of the time it hasn't been,
...until recently.

For example, we are told:

"We share 1/2 of our genetic material with our mother
and 1/2 with our father. We also share 1/2 of our DNA,
on average, with our brothers and sisters. Identical twins
are an exception to this rule. They share their entire DNA between them."
​

And would be immediately expressed in percentage terms as:

"We share 50% of our genetic material with our mother
and 50% with our father. We also share 50% of our DNA,
on average, with our brothers and sisters. Identical twins
are an exception to this rule. They share their entire DNA between them."
​

There is no special lingo needed, no misdirection intended,
no confusion of meaning possible, and the geneticist has no need
of special qualifiers, or technical jargon, to describe the situation.

But having viewed the above statement, which in light of genetic laws
of inheritance is not just clear but obvious and accurate,
the reader will immediately become aware of a huge problem
in the use of the very same language and expression in the claim below:

Who can help but notice that if the claim about parents and siblings is true,
the statement about chimpanzees must be on the face of it FALSE.

How can anyone share more DNA with a monkey than with their own parents?

Of course the answer is in the fact that the Evolutionists have deliberately
misled us by moving the goalposts once again.

It will be no mystery to discover the Evolutionists
have taken very sophisticated and heavily qualified statements
by geneticists, and twisted them around, creating total BS.

That is the problem with simplifying science. Inaccuacies creep in, not due to deception or fraud, but due to words becoming more vague, because definitions are no longer precise.

In this case, the problem is due to simplifying terms and using "gene" when we mean "allele."

All humans have exactly the same genes. Genes are positions on the DNA strands marked off by starting and ending sequences. We all have the same length DNA strands (give or take a few "junk sequences at the end), with starting and ending sequences in the same places (with minor variations due to mutations, which are usually ignored in simplifying the issue, but which might become critical during speciation). Between the starting and ending sequences, there can be different numbers of specific bases in different orders. These different sequences are alleles.

Again simplifying, genes determine how the organism will be affected, while alleles determine what the affect will be. For example, it is the gene for eye color, but the allele for blue eyes or brown eyes.

When it is said that we share 50% of our father's "genes" we are really talking about which specific alleles we inherit from him.

When we say we share 98% of our genes with chimps, we are saying that most of our DNA strands are the same length as chimps and have starting and ending sequences in the same places.

In fact, if I recall correctly, the only difference is one ending sequence and the next starting sequence is missing in chimps, making one longer gene where we have two shorter genes. (or it may be the other way 'round, I'm working from memory here.). So yes, our genes are nearly identical. Of course chimps probably have alleles that we don't have an vice versa, so the differences are not just a matter of that one gene, but the genome project tracks genes, not alleles.

 

[Nazaroo]

When it is said that we share 50% of our father's "genes"
we are really talking about which specific alleles we inherit from him.

When we say we share 98% of our genes with chimps,
we are saying that most of our DNA strands are the same length
as chimps and have starting and ending sequences in the same places.

I won't even argue with you on the definitions you have posted here.

Because regardless, the point then clearly is,
that this is not what people understand when
they read in popular books and articles selling Evolution:

"Chimps and Humans share 96% of their DNA."
​

 

[Subduction Zone]

According to me, the scientific community should stick strictly to these procedures:


(1) State all findings with accompanying calculations for stated precision, and provide evaluations of accuracy, using properly calculated margins of error, etc.

(2) Make sure all statistical claims are accompanied by statements of expected accuracy of results, as is standard with polls, i.e., "this result is expected to be true in 7 out of 10 statistical samples" etc.

(3) State clearly the limits of all measurements, especially sampling techniques, as in "10% sample of the 6 billion nucleotides were checked, and the findings were extrapolated to the other 90% based on the following theory..."

(4) State clearly the theoretical basis for all empirical claims.

(5) Strictly avoid all ambiguous language in reporting findings. In particular, avoid bumbling amateur mistakes, like confusing "similar" with "identical", and failing to state the mathematical type of "average" that is meant.


If propagandists, apologists, and popularizers of scientific findings followed these rules, you wouldn't have fiascos like this.

They tend to do all of that in the peer reviewed articles that the findings were first published in. Your problem is with the various scientific magazines that have to dumb it down a bit so that nonexperts in the field can understand it.

Have you ever read an actual peer reviewed article? Most of them could put the sleeping aids companies out of business. If you don't have a personal interest and knowledge in the topic it makes for some very slow and heavy reading.

 

[OllieFranz]

I won't even argue with you on the definitions you have posted here.

Because regardless, the point then clearly is,
that this is not what people understand when
they read in popular books and articles selling Evolution:

"Chimps and Humans share 96% of their DNA."
​

And as I said, that is because in simplifying for those who do not know even the basics, the words have become vaguer and less precise. Not because of any falsehood or deception.

Edited to add:
I'm sure that I could find examples of people "understanding" simplified Bible stories where the lesson learned is not the lesson taught in the pages of actual scripture. It is a hazard of simplification.

 

[Subduction Zone]

I won't even argue with you on the definitions you have posted here.

Because regardless, the point then clearly is,
that this is not what people understand when
they read in popular books and articles selling Evolution:

"Chimps and Humans share 96% of their DNA."
​

If the people reading it do not understand it whose fault is that?

The peer reviewed articles that started it are available to the public. Yes, if you do want to read them outside of a college library you might have to pay a bit to read them. That is how the journals make money. Not through adds, which biases it towards the advertisers. Not by charging the scientists that write the journal, that biases it towards the writers. But by the people who actually want to learn something new. Hey, that biases it towards new science. What a concept!

 

[Nazaroo]

If the people reading it do not understand it whose fault is that?

The writer's.
When it is deliberate, he should be fired.

 

[sfs]

According to me, the scientific community should stick strictly to these procedures:


(1) State all findings with accompanying calculations for stated precision, and provide evaluations of accuracy, using properly calculated margins of error, etc.

(2) Make sure all statistical claims are accompanied by statements of expected accuracy of results, as is standard with polls, i.e., "this result is expected to be true in 7 out of 10 statistical samples" etc.

(3) State clearly the limits of all measurements, especially sampling techniques, as in "10% sample of the 6 billion nucleotides were checked, and the findings were extrapolated to the other 90% based on the following theory..."

(4) State clearly the theoretical basis for all empirical claims.

(5) Strictly avoid all ambiguous language in reporting findings. In particular, avoid bumbling amateur mistakes, like confusing "similar" with "identical", and failing to state the mathematical type of "average" that is meant.


If propagandists, apologists, and popularizers of scientific findings followed these rules, you wouldn't have fiascos like this.

Read the chimpanzee genome paper, which is the definitive comparison of the human and chimpanzee genomes; you can read it for free here. If there are places where comparisons are misstated or conclusions overstated, I'd like to know about it, since I was one of the authors. Otherwise, I don't care. When scientific studies are simplified for popular consumption, the resulting reports are going to be inaccurate and lack proper nuance. That's just the way things are.

 

[Subduction Zone]

The writer's.
When it is deliberate, he should be fired.

No, the readers.

It is not deliberate. Now what you did in many of your posts was wrong. You misrepresented what odds were being used and how.

Once again, the readers cannot understand the original peer reviewed article. Most of them know that the original is above their head and they trust the writer who simplifies it for them. Since it is a simplification it is almost guaranteed to have certain aspects wrong.

You having a problem with simplified articles is not a valid complaint.

 

[Subduction Zone]

Read the chimpanzee genome paper, which is the definitive comparison of the human and chimpanzee genomes; you can read it for free here. If there are places where comparisons are misstated or conclusions overstated, I'd like to know about it, since I was one of the authors. Otherwise, I don't care. When scientific studies are simplified for popular consumption, the resulting reports are going to be inaccurate and lack proper nuance. That's just the way things are.

I was beaten to the punch, but there you have it from an expert in the field.

Simplification will end up in inaccuracies. They are not deliberate.

If you don't like the inaccuracies then learn enough so that you can understand the original peer reviewed article.

 

[cf123]

I won't even argue with you on the definitions you have posted here.

Because regardless, the point then clearly is,
that this is not what people understand when
they read in popular books and articles selling Evolution:

"Chimps and Humans share 96% of their DNA."
​

but its not just the % we share that supports an idea of evolution but the way DNA works.

DNA allows you to trace your ancestry because your genes had to come from someone down the line for you to exist today. it allows you to group together a cat with a lion to indicate that they came from a close common ancestor.

with humans it groups us together with chimps and primates to suggest we came from a close common ancestor.

there is no desire for DNA to show this link in ancestry - however this is what the evidence suggests to us.

 

[Skaloop]

According to me, the scientific community should stick strictly to these procedures:


(1) State all findings with accompanying calculations for stated precision, and provide evaluations of accuracy, using properly calculated margins of error, etc.

(2) Make sure all statistical claims are accompanied by statements of expected accuracy of results, as is standard with polls, i.e., "this result is expected to be true in 7 out of 10 statistical samples" etc.

(3) State clearly the limits of all measurements, especially sampling techniques, as in "10% sample of the 6 billion nucleotides were checked, and the findings were extrapolated to the other 90% based on the following theory..."

(4) State clearly the theoretical basis for all empirical claims.

(5) Strictly avoid all ambiguous language in reporting findings. In particular, avoid bumbling amateur mistakes, like confusing "similar" with "identical", and failing to state the mathematical type of "average" that is meant.


If propagandists, apologists, and popularizers of scientific findings followed these rules, you wouldn't have fiascos like this.

They do those things when they publish their findings in scientific journals. It's not the scientists who are "misleading", it's the popular media because most people either won't understand it or don't care about those details. But it's out there for you to find if you do care. Go read some real scientific articles some time; you'll find that they are chock full of statistics, methodologies, the assumptions used, and even the hard data.

The scientific community does everything you ask them to do, and more, so your problem is not with them.

 

[Nazaroo]

They do those things when they publish their findings in scientific journals. It's not the scientists who are "misleading", it's the popular media because most people either won't understand it or don't care about those details. But it's out there for you to find if you do care. Go read some real scientific articles some time; you'll find that they are chock full of statistics, methodologies, the assumptions used, and even the hard data.

The scientific community does everything you ask them to do, and more, so your problem is not with them.

If you stick to a very much smaller list of reputable scientists,
and professional scientific journals and university publications,
then you are correct.

The problem isn't just blaming a few media mavericks.
The problem is one of defining exactly where the strictly scientific community starts and ends.

Many journals and magazines would like the recognition and prestige
of being considered a respected scientific journal,
but we all know that most are not up to the task.

In the same manner, scientists themselves form a bell-curve,
of worst, average, and best, in terms of accuracy and insight,
and strict scientific methodology. Only a top percentage
really deserve the credit and credibility that the best have earned.

Likewise, the educational system, along with its many propagandists,
apologists, and pop-science commentators is a sprawling and
often inaccurate dissemination engine of a very uneven mixture
of science, quasi-science, semi-science, pseudo-science, and scientism.

But they all want to be called "scientists".

 

[Nazaroo]

...there you have it...

Simplification will end up in inaccuracies. They are not deliberate.

You seem to speak with two tongues,
and an obvious bias.

On the one hand, you are insisting that
all inaccuracies made by Evolutionists are accidental,
but all *alleged* inaccuracies by me are deliberate LIES.

Not only have you applied a double-standard,
but your own behavior is precisely what
you are accusing me of doing deliberately.

But you didn't even restrain yourself
to accuse me of bias, but actually of fabricating outright lies.

Even if this outrageous accusation had contained any truth,
you are plainly violating the forum rules again.

This is not a venue for Ad Hominem personal attacks
on other posters,
and I will ask you again to cease and desist.

 

[46AND2]

If you stick to a very much smaller list of reputable scientists,
and professional scientific journals and university publications,
then you are correct.

The problem isn't just blaming a few media mavericks.
The problem is one of defining exactly where the strictly scientific community starts and ends.

Many journals and magazines would like the recognition and prestige
of being considered a respected scientific journal,
but we all know that most are not up to the task.

In the same manner, scientists themselves form a bell-curve,
of worst, average, and best, in terms of accuracy and insight,
and strict scientific methodology. Only a top percentage
really deserve the credit and credibility that the best have earned.

Likewise, the educational system, along with its many propagandists,
apologists, and pop-science commentators is a sprawling and
often inaccurate dissemination engine of a very uneven mixture
of science, quasi-science, semi-science, pseudo-science, and scientism.

But they all want to be called "scientists".

Why do you think we established the peer-reviewed journal system? hmm.

 

[Skaloop]

If you stick to a very much smaller list of reputable scientists,
and professional scientific journals and university publications,
then you are correct.

The problem isn't just blaming a few media mavericks.
The problem is one of defining exactly where the strictly scientific community starts and ends.

Many journals and magazines would like the recognition and prestige
of being considered a respected scientific journal,
but we all know that most are not up to the task.

In the same manner, scientists themselves form a bell-curve,
of worst, average, and best, in terms of accuracy and insight,
and strict scientific methodology. Only a top percentage
really deserve the credit and credibility that the best have earned.

Likewise, the educational system, along with its many propagandists,
apologists, and pop-science commentators is a sprawling and
often inaccurate dissemination engine of a very uneven mixture
of science, quasi-science, semi-science, pseudo-science, and scientism.

But they all want to be called "scientists".

And there are top scientists who have followed the scientific process and published all supporting documentation (that you can find and read yourself) showing where the various percentage relationships/similarities come from, how they arrived at their conclusions, what they were measuring, what they were comparing, the confidence levels of their statistics, etc. etc. All the stuff you demand has been done.

That "lesser" scientists may not go into such detail when discussing the issue, or that pop-science magazines don't include all the background data does not negate the finding of those top scientists who did the work and properly published the results. And the findings are that we are extremely genetically similar to our direct parents, slightly less genetically similar to other kin humans, slightly less genetically similar to other humans, slightly less genetically similar to other great apes, slightly less genetically similar to mice... And on it goes. The top scientists have demonstrated it and shown their work. If you want to show them to be wrong, you're going to have to do the same. But better, because between them all, they've done it a lot.