For those wishing DNA worked exactly like computer code

[tas8831]

Posted this on another forum. It came up here yesterday, so I thought it might be relevant.


ANALOGY:

Definition of analogy

1a: a comparison of two otherwise unlike things based on resemblance of a particular aspect
b: resemblance in some particulars between things otherwise unlike : SIMILARITY

2: inference that if two or more things agree with one another in some respects they will probably agree in others

3: correspondence between the members of pairs or sets of linguistic forms that serves as a basis for
the creation of another form
​

When I used to teach Biology 101, I would use the classic English Language analogy when introducing students to DNA and Genetics.
Analogies are (or can be) good teaching tools to convey complex subjects to those who are unfamiliar with the subject matter, by making a comparison with that complex material and something more common and understandable.
It goes something like this - The Nucleotides are like letters, the Exons are like words, a Gene is like a sentence, a Genome is like a book, etc., at least that is how I approached it. This is all very simplistic (by design) , but it usually helps get the basic points across.
I was always sure to make it clear that this is pretty much where the analogy ends. I would explain that genes can be very different from sentences, that genomes, unlike books, contain lots of 'chapters' repeated over and over, or parts of them repeated, etc. But again, the analogy was good enough to get the basics across.

It seems that many people never got that caution, and were apparently told, or it was implied, or they need it to be so that the analogy is almost exactly a 1-to-1 directly applicable comparison. And many of those same folks read a book or more likely an internet essay about "genetic information", where direct analogies - just as inapplicable as the language analogies - are employed in which it is asserted that genes/genomes are exactly like computer code, and subject to the exact same constraints. This is why, for example, we see creationists - even on this forum, even today - claiming, for example that "rearranging the things that are already there is not new information". That claim is usually accompanied by something like "and you need new information to make a new part." I have even seem some intrepid anti-evolutionists provide specific (and wholly indefensible) numbers - one fellow claimed on another forum many years ago that 'we' needed at least 1 "brand new protein" to make a new body part, and that this required at least 333 mutations-worth of new information. I asked why, and how he knew this, but I never got a reply (of course). I also once had a rather well-known (at least on the internet) creationist declare that 'we' would need at least 1 million mutations to turn an ape pelvis into a human one. I asked for a list of 10 of these changes that were needed and how many mutations each would require and how he knew this. No answer, and it has been about 11 years... Anyway:

These language/computer code/ "information" constraints that are foisted upon evolution include (but are definitely not limited to):

1. You cannot just rearrange what is there and get anything new
2. You cannot just copy-paste what is already there and get anything new
3. You cannot screw up the code/word and expect something new or good to come of it

I first encountered the language analogy argument against evolution way back in the early 1990s, in the first creationism book I ever read. I don't remember the book, specifically, but I later learned that the example in this book had made the rounds and was pretty common amongst creationists. It went something like this, and it basically encompasses the three constraints above:

Here is a simple sentence:

The dog ran fast.

Now let us 'evolve' it:

The dog ran fast. The dog ran fast.

The dog dog ran fast.

The ran dog fast.

The dig ran fast.

Isn't that CRAZY??? Those sentences don't make any sense! Obviously, this is not how evolution works. Because it DOESN'T work!​

In reality, we see:

The dog ran fast. The dog ran fast.

Diet and the evolution of human amylase gene copy number variation
Abstract
Starch consumption is a prominent characteristic of agricultural societies and hunter-gatherers in arid environments. In contrast, rainforest and circum-arctic hunter-gatherers and some pastoralists consume much less starch1,2,3. This behavioral variation raises the possibility that different selective pressures have acted on amylase, the enzyme responsible for starch hydrolysis4. We found that copy number of the salivary amylase gene (AMY1) is correlated positively with salivary amylase protein level and that individuals from populations with high-starch diets have, on average, more AMY1 copies than those with traditionally low-starch diets. Comparisons with other loci in a subset of these populations suggest that the extent of AMY1 copy number differentiation is highly unusual. This example of positive selection on a copy number–variable gene is, to our knowledge, one of the first discovered in the human genome. Higher AMY1 copy numbers and protein levels probably improve the digestion of starchy foods and may buffer against the fitness-reducing effects of intestinal disease.




The dog dog ran fast.

Common exon duplication in animals and its role in alternative splicing
Abstract
When searching the genomes of human, fly and worm for cases of exon duplication, we found that about 10% of all genes contain tandemly duplicated exons. In the course of the analyses, 2438 unannotated exons were identified that are not currently included in genome databases and that are likely to be functional. The vast majority of them are likely to be involved in mutually exclusive alternative splicing events. The common nature of recent exon duplication indicates that it might have a significant role in the fast evolution of eukaryotic genes. It also provides a general mechanism for the regulation of protein function.


The ran dog fast.

Evolutionary history of exon shuffling
Abstract
Exon shuffling has been characterized as one of the major evolutionary forces shaping both the genome and the proteome of eukaryotes. This mechanism was particularly important in the creation of multidomain proteins during animal evolution, bringing a number of functional genetic novelties. Here, genome information from a variety of eukaryotic species was used to address several issues related to the evolutionary history of exon shuffling. By comparing all protein sequences within each species, we were able to characterize exon shuffling signatures throughout metazoans. Intron phase (the position of the intron regarding the codon) and exon symmetry (the pattern of flanking introns for a given exon or block of adjacent exons) were features used to evaluate exon shuffling. We confirmed previous observations that exon shuffling mediated by phase 1 introns (1-1 exon shuffling) is the predominant kind in multicellular animals. Evidence is provided that such pattern was achieved since the early steps of animal evolution, supported by a detectable presence of 1-1 shuffling units in Trichoplax adhaerens and a considerable prevalence of them in Nematostella vectensis. In contrast, Monosiga brevicollis, one of the closest relatives of metazoans, and Arabidopsis thaliana, showed no evidence of 1-1 exon or domain shuffling above what it would be expected by chance. Instead, exon shuffling events are less abundant and predominantly mediated by phase 0 introns (0-0 exon shuffling) in those non-metazoan species. Moreover, an intermediate pattern of 1-1 and 0-0 exon shuffling was observed for the placozoan T. adhaerens, a primitive animal. Finally, characterization of flanking intron phases around domain borders allowed us to identify a common set of symmetric 1-1 domains that have been shuffled throughout the metazoan lineage.


The dig ran fast.

Point Mutations with Positive Selection Were a Major Force during the Evolution of a Receptor-Kinase Resistance Gene Family of Rice
ABSTRACT
The rice (Oryza sativa) Xa26 gene, which confers resistance to bacterial blight disease and encodes a leucine-rich repeat (LRR) receptor kinase, resides at a locus clustered with tandem homologous genes. To investigate the evolution of this family, four haplotypes from the two subspecies of rice, indica and japonica, were analyzed. Comparative sequence analysis of 34 genes of 10 types of paralogs of the family revealed haplotype polymorphisms and pronounced paralog diversity. The orthologs in different haplotypes were more similar than the paralogs in the same haplotype. At least five types of paralogs were formed before the separation of indica and japonica subspecies. Only 7% of amino acid sites were detected to be under positive selection, which occurred in the extracytoplasmic domain. Approximately 74% of the positively selected sites were solvent-exposed amino acid residues of the LRR domain that have been proposed to be involved in pathogen recognition, and 73% of the hypervariable sites detected in the LRR domain were subject to positive selection. The family is formed by tandem duplication followed by diversification through recombination, deletion, and point mutation. Most variation among genes in the family is caused by point mutations and positive selection.

I also looked at a couple papers on the Titin gene, as I had remembered from some years ago a discussion on that on a forum, but I could not find the paper I had used before. I did, however, come across this figure - all the red blocks are identical or nearly identical Ig-like domains:

Largest protein we make. LOTS of what we are told is not 'new information' and just 'copies of what is already there' jammed together to make a gene that makes an important protein.


That handles both the language and 'information' "arguments via analogy", I believe, but there is one more 'information' issue that I would like to address - the claim that 'just changing what is already there does not create new information, therefore, no adaptive evolution can occur' or words to that effect.

This paper documents an insertion event (a mutation in which a large chunk of DNA is inserted in one event) within the promoter region of a gene which causes the gene to be over-transcribed, i.e., just more of the same protein is made. No 'new' protein, just "information" that makes more of it. And it confers an adaptive benefit:

A single p450 allele associated with insecticide resistance in Drosophila.
"...Transgenic analysis of Cyp6g1 shows that over-transcription of this gene alone is both necessary and sufficient for resistance. Resistance and up-regulation in Drosophila populations are associated with a single Cyp6g1 allele that has spread globally. This allele is characterized by the insertion of an Accord transposable element into the 5' end of the Cyp6g1 gene."

I'm sure the fallacy-mongers will be out in force (if they do not just ignore it all) and try to find ways to diminish or deny - I have presented the p450 many times, once had a creationist dismiss it because it did not produce a 'new limb'!! :facepalm:
:shrug:
That analogies are not evidence will be their burden to bear.

 

[mindfulzen]

So, DNA is essentially like ever evolving blockchains, and blockchain technology is based on DNA, if I get your point. I skimmed some, it was long and informative. will read it all later. And does this makes you wonder about God, or strengthen you as atheist? Was not clear for me. It strengthens it to me. Partly why I became christian.

 

[Mark Quayle]

The dog ran fast. The dog ran fast.

The dog dog ran fast.

The ran dog fast.

The dig ran fast.

Isn't that CRAZY??? Those sentences don't make any sense! Obviously, this is not how evolution works. Because it DOESN'T work!

I'm trying to follow here. And I'm not trying to disagree with you here.

Your statement: "...this is not how evolution works. Because it DOESN'T work!", sounds like confirmation bias. It sounds like you are saying that since evolution works, these sentences (which don't work, i.e. "don't make sense") don't apply.

 

[tas8831]

I'm trying to follow here. And I'm not trying to disagree with you here.

Your statement: "...this is not how evolution works. Because it DOESN'T work!", sounds like confirmation bias.

Yes, it is confirmation bias. A common creationist tactic to employ. I guess you missed the context:

I first encountered the language analogy argument against evolution way back in the early 1990s, in the first creationism book I ever read. I don't remember the book, specifically, but I later learned that the example in this book had made the rounds and was pretty common amongst creationists. It went something like this, and it basically encompasses the three constraints above:​

It sounds like you are saying that since evolution works, these sentences (which don't work, i.e. "don't make sense") don't apply.

Yes - and I followed those up with refutations of their implication.
I remember that you wrote before that you are not a scientist or something similar. I offered scientific refutations of the general claims that anti-evolutionists like to use wrt the use of simplistic analogies to English language (and by implication, to computer code).

I can explain the science if you want to understand why the analogies fail, and maybe you can explain why creationists continue to use failed analogies rather than actual data.

 

[tas8831]

So, DNA is essentially like ever evolving blockchains, and blockchain technology is based on DNA, if I get your point.

I have no idea how blockchain tech works, but your comment inspired me to look around a bit. I did not see that it is based on DNA, but that certain groups are looking into ways to use blockchain tech to deal with DNA data.
In fact, I read the abstract of one paper that essentially relied on the analogies (in general) that I wrote above:

"Biological cells can transmit, process and receive chemically encoded data in the same way as network devices transmit, process, and receive digitally encoded data."​

Sure, except that DNA is an organic molecule that 'transmits' data via physicochemical interactions of molecules. not via electrons, but whatever.


If analogies inspire tech advances, good. But it is an error to equate tech with DNA/genetics/genomics. Especially since I have had any number of people tell me, emphatically, that because DNA operates "just like" computer tech that standard evidence-based reality re: how DNA operates cannot be so for computer tech cannot do that.
I referred specifically to the language stuff in the OP, but, as one example, we have @Guy Threepwood on this forum just recently claiming that evolution is in trouble because of the precision with which 'digital information' must be processed, or some such silliness. As another, many years ago a person who ran his own computer science group (and a creationist) insisted much the same - that even tiny perturbations in DNA sequence are devastating because that is what happens in computer code. That chap was very interesting, in a typical way for creationists, in that he later 100% contradicted himself when I provided evidence that up to ~30% of a gene's DNA sequence could hypothetically change and not affect its function (based on the redundancy of the genetic code in conjunction with the wobble hypothesis) - he then insisted that, my goodness, so can computer code!

I skimmed some, it was long and informative. will read it all later. And does this makes you wonder about God, or strengthen you as atheist? Was not clear for me. It strengthens it to me. Partly why I became christian.

I do not wonder about deities anymore and have never felt compelled to strengthen my conclusions about such things. Once I realized what religion is really about, and how ancient tales deceive more than inform, I never really felt the need to.
That being said, if an anthropomorphic being descended from On High (wherever that might be) and produced real miracles in real-time (amputees having their limbs pop back from nothing, reduce the CO2 levels in the atmosphere to pre-industrial levels in an instant - something tangible and real as opposed to tree stumps looking like Jesus or weeping statues), I would drop to my knees as I am driven by evidence, not feelings, traditions, etc.

 

[mindfulzen]

I have no idea how blockchain tech works, but your comment inspired me to look around a bit. I did not see that it is based on DNA, but that certain groups are looking into ways to use blockchain tech to deal with DNA data.
In fact, I read the abstract of one paper that essentially relied on the analogies (in general) that I wrote above:

"Biological cells can transmit, process and receive chemically encoded data in the same way as network devices transmit, process, and receive digitally encoded data."​

Sure, except that DNA is an organic molecule that 'transmits' data via physicochemical interactions of molecules. not via electrons, but whatever.


If analogies inspire tech advances, good. But it is an error to equate tech with DNA/genetics/genomics. Especially since I have had any number of people tell me, emphatically, that because DNA operates "just like" computer tech that standard evidence-based reality re: how DNA operates cannot be so for computer tech cannot do that.
I referred specifically to the language stuff in the OP, but, as one example, we have @Guy Threepwood on this forum just recently claiming that evolution is in trouble because of the precision with which 'digital information' must be processed, or some such silliness. As another, many years ago a person who ran his own computer science group (and a creationist) insisted much the same - that even tiny perturbations in DNA sequence are devastating because that is what happens in computer code. That chap was very interesting, in a typical way for creationists, in that he later 100% contradicted himself when I provided evidence that up to ~30% of a gene's DNA sequence could hypothetically change and not affect its function (based on the redundancy of the genetic code in conjunction with the wobble hypothesis) - he then insisted that, my goodness, so can computer code!


I do not wonder about deities anymore and have never felt compelled to strengthen my conclusions about such things. Once I realized what religion is really about, and how ancient tales deceive more than inform, I never really felt the need to.
That being said, if an anthropomorphic being descended from On High (wherever that might be) and produced real miracles in real-time (amputees having their limbs pop back from nothing, reduce the CO2 levels in the atmosphere to pre-industrial levels in an instant - something tangible and real as opposed to tree stumps looking like Jesus or weeping statues), I would drop to my knees as I am driven by evidence, not feelings, traditions, etc.

I may have worded it poorly. Not saying that blockchain is identical to DNC, but similar. Everlasting new sequences of sourcecodes evolving by each transaction. Like a small change by each generation, after illness and other stuff somewhat improve our genetic code, to protect us better against diseases, etc. Action/reaction/alter. And very in the time now, since we in a vaccinesituation, where we are trying to rewrite our immunesystem, and sort of hide behind a firewall, and then you have the virus mutating to crack the firewall, and we must alter the next one, and on and on and on. Like updating antivirus if you will. If you think it goes to far with blockchain/cryptography

But it does seem to coincide somewhat in history. Not sure about when we were able to decode DNA, but the cryptography got started in 1975 or thereabouts. And seems to be a bit paralell development, as far as the official is concerned. Who knows how long they really researched it. The sequences look similar, but might just ber because of how complex it is. And seems smart to base cryptography on DNA, when DNA is so hard to decode. Only logical when dealing with security, new currency, new way of securing elections, and countless applications to incorporate it into. Very interesting stuff. Will read some more about it. And check back later.

 

[tas8831]

I may have worded it poorly. Not saying that blockchain is identical to DNC, but similar.

That you did, but I was referring to other individuals that have indeed claimed 'identical' or very nearly so.

Everlasting new sequences of sourcecodes evolving by each transaction. Like a small change by each generation, after illness and other stuff somewhat improve our genetic code, to protect us better against diseases, etc.

An analogy, indeed. But analogies are just that.

Action/reaction/alter. And very in the time now, since we in a vaccinesituation, where we are trying to rewrite our immunesystem,

The immune system is not re-written by vaccines. There are already cells that can potentially recognize any antigen-bearing pathogen one can imagine - there are something like 950 known human pathogens, each carrying at least 1 antigen that our immune cells can bind to. At any given time, we have something like 10 billion B cells and 40000000000 different T-cells, each of which will have slightly different sets of receptors, produced during their development. The odds a re very good that each of us will have at least a few cells that have a receptor that can bind the antigens of any pathogen in existence. Upon that interaction occurring, an immune response occurs at the conclusion of which we are left with many more cells with the appropriate receptor type (memory cells). This makes a subsequent exposure to the same pathogen faster and stronger. The only DNA that gets rewritten is the specific genes associated with the development of these receptors, and this is not passed on to offspring. If it was, we would all be immune to basically everything at birth (except for new pathogens). Vaccines simply allow our immune system to recognize the pathogen and go through this process
without having to deal with the actual pathogen itself.

and sort of hide behind a firewall, and then you have the virus mutating to crack the firewall, and we must alter the next one, and on and on and on. Like updating antivirus if you will. If you think it goes to far with blockchain/cryptography

Like I wrote in the OP, analogies are fine for the basics, but there is a limit to their utility.

But it does seem to coincide somewhat in history. Not sure about when we were able to decode DNA, but the cryptography got started in 1975 or thereabouts.

The structure of DNA was published in 1952. DNA sequencing came about in the early 1970s.

And seems to be a bit paralell development, as far as the official is concerned.

Lots of things occurred in parallel in terms of technology. The initial sequencing reactions were done by hand. As technology advanced, new more efficient methods were developed, just as better computers and such were developed. But we can say the same about anything that is technology or relies on technology. Cars, HVAC systems, aircraft.

The sequences look similar, but might just ber because of how complex it is.

I assume you mean DNA? We (humans) have actually traced changes in DNA over many generations. Being able to do so is the foundation of the field of molecular phylogenetics.

And seems smart to base cryptography on DNA, when DNA is so hard to decode.

The downside there is that DNA 'coding' doesn't actually change, the specific sequences do. And once the role of those specific sequences are discovered, no more cryptic-ness (? is that a word?).

Only logical when dealing with security, new currency, new way of securing elections, and countless applications to incorporate it into. Very interesting stuff. Will read some more about it. And check back later.

It is interesting, but again, I would caution against going too far and drawing unwarranted conclusions from analogies.

 

[Mark Quayle]

Yes, it is confirmation bias. A common creationist tactic to employ. I guess you missed the context:

I first encountered the language analogy argument against evolution way back in the early 1990s, in the first creationism book I ever read. I don't remember the book, specifically, but I later learned that the example in this book had made the rounds and was pretty common amongst creationists. It went something like this, and it basically encompasses the three constraints above:​

Yes - and I followed those up with refutations of their implication.
I remember that you wrote before that you are not a scientist or something similar. I offered scientific refutations of the general claims that anti-evolutionists like to use wrt the use of simplistic analogies to English language (and by implication, to computer code).

I can explain the science if you want to understand why the analogies fail, and maybe you can explain why creationists continue to use failed analogies rather than actual data.

Please do. But bear in mind, I try not to think in terms of analogy. All analogies fail at some point. (This is true of both sides, and even when I use analogies). I tend to get lost when analogies are presented, because, despite not being a scientist as such, I see 'fail' almost from the beginning of each one. My mind often tends to run on ahead of my eyes.

"Ok, but..." comes too often to bother posting, specially when my objections get shouted down before they are even understood.

 

[tas8831]

Please do.

OK, I will take one at a time as I am supposed to be doing real work... (see below)

But bear in mind, I try not to think in terms of analogy. All analogies fail at some point. (This is true of both sides, and even when I use analogies).

Agreed.

I tend to get lost when analogies are presented, because, despite not being a scientist as such, I see 'fail' almost from the beginning of each one. My mind often tends to run on ahead of my eyes.

Good thinking.

"Ok, but..." comes too often to bother posting, specially when my objections get shouted down before they are even understood.

OK, I am probably guilty of that. But it comes from experience, as I have been on forums like this for more than 25 years off and on, and am pretty used to the sorts of objections that I can expect to encounter.

#1
This one is in response to this kind of scenario:

The dog ran fast. The dog ran fast.​

That pair of sentences (or something very much like it) is the sort of 'analogy' I have seen from anti-evolutionists attempting to dismiss the notion that gene duplications can possibly be a good thing, and that is premised as best I can tell on the notion that 'repeating what is already there does not add new information, and (according to the 'information' mongers like Dembski) 'new information' is required for adaptation/evolution'. Because after all, writing those sentences twice in a row does not alter their impact or tell us anything more about the dog.
Gene duplication is a pretty common event, and the evidence indicates that it is the culprit behind the generation of most gene families. A gene family is a group of genes of very similar sequence, typically all right next to each other on a chromosome, within which individual genes have been erroneously copied during DNA synthesis and over time, the duplicates have accumulated mutational change. Some of these duplicates mutate out of functionality (these are called pseudogenes - still recognizable by their sequence, but not actively transcribed), others acquire similar but divergent function, and sometimes new functions altogether. The Beta Globin gene cluster is probably among the most studied of these gene families.
In other cases, the duplication events have occurred relatively recently, and the duplicates have generally not had time to accumulate sufficient DNA change to alter their function, but having an extra copy of a functioning gene can still affect physiology/phenotype. The paper cited and quoted below is an example of this, and shows that 'duplicating what s already there' does allow for adaptation, so the whole 'no new information'/'those sentences written twice make no sense' argument is rendered moot.


Human populations can vary in the number of copies of the gene for Amylase, a starch-digesting protein. Starch is an important source of glucose, our (animals) main source of "fuel" to make ATP in cells. Having additional copies of this gene increases the amount of Amylase produced, allowing for populations that have these duplicated genes to more readily digest starch and thus have more 'freed up fuel', making metabolic processes more efficient (among other things). And as is concluded in the abstract below, this appears to be an adaptive trait premised solely on having "more of what is already there."

Diet and the evolution of human amylase gene copy number variation
Abstract
Starch consumption is a prominent characteristic of agricultural societies and hunter-gatherers in arid environments. In contrast, rainforest and circum-arctic hunter-gatherers and some pastoralists consume much less starch1,2,3. This behavioral variation raises the possibility that different selective pressures have acted on amylase, the enzyme responsible for starch hydrolysis4. We found that copy number of the salivary amylase gene (AMY1) is correlated positively with salivary amylase protein level and that individuals from populations with high-starch diets have, on average, more AMY1 copies than those with traditionally low-starch diets. Comparisons with other loci in a subset of these populations suggest that the extent of AMY1 copy number differentiation is highly unusual. This example of positive selection on a copy number–variable gene is, to our knowledge, one of the first discovered in the human genome. Higher AMY1 copy numbers and protein levels probably improve the digestion of starchy foods and may buffer against the fitness-reducing effects of intestinal disease.

 

[mindfulzen]

That you did, but I was referring to other individuals that have indeed claimed 'identical' or very nearly so.

An analogy, indeed. But analogies are just that.

The immune system is not re-written by vaccines. There are already cells that can potentially recognize any antigen-bearing pathogen one can imagine - there are something like 950 known human pathogens, each carrying at least 1 antigen that our immune cells can bind to. At any given time, we have something like 10 billion B cells and 40000000000 different T-cells, each of which will have slightly different sets of receptors, produced during their development. The odds a re very good that each of us will have at least a few cells that have a receptor that can bind the antigens of any pathogen in existence. Upon that interaction occurring, an immune response occurs at the conclusion of which we are left with many more cells with the appropriate receptor type (memory cells). This makes a subsequent exposure to the same pathogen faster and stronger. The only DNA that gets rewritten is the specific genes associated with the development of these receptors, and this is not passed on to offspring. If it was, we would all be immune to basically everything at birth (except for new pathogens). Vaccines simply allow our immune system to recognize the pathogen and go through this process
without having to deal with the actual pathogen itself.

Like I wrote in the OP, analogies are fine for the basics, but there is a limit to their utility.

The structure of DNA was published in 1952. DNA sequencing came about in the early 1970s.
Lots of things occurred in parallel in terms of technology. The initial sequencing reactions were done by hand. As technology advanced, new more efficient methods were developed, just as better computers and such were developed. But we can say the same about anything that is technology or relies on technology. Cars, HVAC systems, aircraft.

I assume you mean DNA? We (humans) have actually traced changes in DNA over many generations. Being able to do so is the foundation of the field of molecular phylogenetics.
The downside there is that DNA 'coding' doesn't actually change, the specific sequences do. And once the role of those specific sequences are discovered, no more cryptic-ness (? is that a word?).

It is interesting, but again, I would caution against going too far and drawing unwarranted conclusions from analogies.

Why are you on about linguistics about analogies being verboten or something? It is just a way to communicate simplified, so it is easily understood amongs those not in the know, and make it readily available for a larger audience. Useful tool, that professors above all others should understand the value of. Those who use it effectively, to convery highly complical stuff in an easy to understand way. Especially in theese two subjects, how can we invite folks into cryptography and DNA, by using a language they do not understand, and makes them give up? That is not very good missionary, if you really want folks to learn about DNA, on a christian forum.

You can claim that DNC is not reprogrammed by vaccines, but they are, and is why we debate the vaccine now, with much anger from some. And are reprogrammed if we get the virus, ref the black plague that wiped out 1/3 of europeans in the 1300s. And today the people here responds the best after getting this virus, and generally have better health, lower GMI, less heartdisease, etc. Especially here in scandinavia. Nature is a mad hacker programming like 90 going north. The body kind of has IA, it learns. You got to love that analogy, the body or the mind is selflearned intelligence. And this portion of claims in your first post, is totally not true at all.

"These language/computer code/ "information" constraints that are foisted upon evolution include (but are definitely not limited to):

1. You cannot just rearrange what is there and get anything new
2. You cannot just copy-paste what is already there and get anything new
3. You cannot screw up the code/word and expect something new or good to come of it"

I think we can modify DNA quite a bit now, they are 15-20 years ahead of what they tell us. And you can sterilize with meds, and do other bad stuff, so you just study and isolate the counterresponse and find the DNA strain that combat it, and you can do it on a large scale. And then you do trial and error on altering that genome strain, and finally you find the key. Then you can test it in testtube babies. Then you can try it in meds to alter the strain in medtrials on people, and deprogram a protectionmechanism learned by the body. And of course they can see the limits of protection and test it's resistance. Then exceed it, and give killshots for that protection. This biowarfare is very much being researched. And you can mess with the XY chromosomes, and mess up genders. You can as in registries on computers paste in sourcecodes that will create a DNA error code 404, and make disabled people. The creation of a life is fragile and defencemechanism not strong early on, evil people with much knowledge can destroy babies that have not grown fully in the womb.

And you kind of answer it yourself, 10 million B-cells, and 400blahblahblah T-cells, and communicating with receptors? What if the communication link is broken? What if you make them occupied by emulating, and make them busy respnding to something else, while simultaniously infecting it with something stealthier, so it gets overlooked and alter? You aknowledge that medical science can produce smarter meds to fight diseases, making them respond to smaller threats as if it is an attack they must combat? And that failed ones do not get that response, so there is a balance here between perceived threat and going unnoticed and harmless. So making a harmless threat make the body go into total panicmode, then giving it a less obvious housten we have a problem that is more dangerous and unknown will go undetected and uncombatted?

What is the big deal? We are all gods little smartphones walking around on earth and getting updated by him. I run on Goddroid version 8.756.777. How about you?

 

[FrumiousBandersnatch]

Why are you on about linguistics about analogies being verboten or something? It is just a way to communicate simplified, so it is easily understood amongs those not in the know, and make it readily available for a larger audience. Useful tool, that professors above all others should understand the value of. Those who use it effectively, to convery highly complical stuff in an easy to understand way. Especially in theese two subjects, how can we invite folks into cryptography and DNA, by using a language they do not understand, and makes them give up? That is not very good missionary, if you really want folks to learn about DNA, on a christian forum.

You can claim that DNC is not reprogrammed by vaccines, but they are, and is why we debate the vaccine now, with much anger from some. And are reprogrammed if we get the virus, ref the black plague that wiped out 1/3 of europeans in the 1300s. And today the people here responds the best after getting this virus, and generally have better health, lower GMI, less heartdisease, etc. Especially here in scandinavia. Nature is a mad hacker programming like 90 going north. The body kind of has IA, it learns. You got to love that analogy, the body or the mind is selflearned intelligence. And this portion of claims in your first post, is totally not true at all.

"These language/computer code/ "information" constraints that are foisted upon evolution include (but are definitely not limited to):

1. You cannot just rearrange what is there and get anything new
2. You cannot just copy-paste what is already there and get anything new
3. You cannot screw up the code/word and expect something new or good to come of it"

I think we can modify DNA quite a bit now, they are 15-20 years ahead of what they tell us. And you can sterilize with meds, and do other bad stuff, so you just study and isolate the counterresponse and find the DNA strain that combat it, and you can do it on a large scale. And then you do trial and error on altering that genome strain, and finally you find the key. Then you can test it in testtube babies. Then you can try it in meds to alter the strain in medtrials on people, and deprogram a protectionmechanism learned by the body. And of course they can see the limits of protection and test it's resistance. Then exceed it, and give killshots for that protection. This biowarfare is very much being researched. And you can mess with the XY chromosomes, and mess up genders. You can as in registries on computers paste in sourcecodes that will create a DNA error code 404, and make disabled people. The creation of a life is fragile and defencemechanism not strong early on, evil people with much knowledge can destroy babies that have not grown fully in the womb.

And you kind of answer it yourself, 10 million B-cells, and 400blahblahblah T-cells, and communicating with receptors? What if the communication link is broken? What if you make them occupied by emulating, and make them busy respnding to something else, while simultaniously infecting it with something stealthier, so it gets overlooked and alter? You aknowledge that medical science can produce smarter meds to fight diseases, making them respond to smaller threats as if it is an attack they must combat? And that failed ones do not get that response, so there is a balance here between perceived threat and going unnoticed and harmless. So making a harmless threat make the body go into total panicmode, then giving it a less obvious housten we have a problem that is more dangerous and unknown will go undetected and uncombatted?

What is the big deal? We are all gods little smartphones walking around on earth and getting updated by him. I run on Goddroid version 8.756.777. How about you?

Vaccines don't modify DNA.

 

[tas8831]

Why are you on about linguistics about analogies being verboten or something?

I am on about linguistics and such because that it what I started this thread for (for the most part). Analogies are fine, but they are not evidence, and many creationist use analogies as evidence because they do not understand the evidence.

It is just a way to communicate simplified, so it is easily understood amongs those not in the know,

Yes, I wrote as much in the OP:

When I used to teach Biology 101, I would use the classic English Language analogy when introducing students to DNA and Genetics.
Analogies are (or can be) good teaching tools to convey complex subjects to those who are unfamiliar with the subject matter, by making a comparison with that complex material and something more common and understandable.​

I also then explained why they fail above a certain level:

I was always sure to make it clear that this is pretty much where the analogy ends. I would explain that genes can be very different from sentences, that genomes, unlike books, contain lots of 'chapters' repeated over and over, or parts of them repeated, etc. But again, the analogy was good enough to get the basics across.​

And further what the relevance is to creationists and their antics:

It seems that many people never got that caution, and were apparently told, or it was implied, or they need it to be so that the analogy is almost exactly a 1-to-1 directly applicable comparison. And many of those same folks read a book or more likely an internet essay about "genetic information", where direct analogies - just as inapplicable as the language analogies - are employed in which it is asserted that genes/genomes are exactly like computer code, and subject to the exact same constraints.​

Especially in theese two subjects, how can we invite folks into cryptography and DNA, by using a language they do not understand, and makes them give up? That is not very good missionary, if you really want folks to learn about DNA, on a christian forum.

I do not get paid to teach creationists on an internet forum, and so will not waste the effort on people so affected by the Dunning-Kruger effect.
The creationists I encounter on these sorts of forums nearly ALWAYS present themselves as knowing all about it in the first place, despite the fact that most of them know next to nothing about it, and rely on the disinformation fed to them by their creationist heroes. I can usually tell after a sentence or two whether or not a creationist understands the things they pontificate about. Like when you wrote that vaccines change the DNA, I knew that you did understand how vaccines work.

You can claim that DNC is not reprogrammed by vaccines, but they are,

That is false.

and is why we debate the vaccine now, with much anger from some. And are reprogrammed if we get the virus, ref the black plague that wiped out 1/3 of europeans in the 1300s.

That is not programming the DNA.

And today the people here responds the best after getting this virus, and generally have better health, lower GMI, less heartdisease, etc. Especially here in scandinavia.

I will need to see a reference for that. In the rest of the world, Covid-19 often produces long-term effects, some of which may be permanent.
COVID-19 (coronavirus): Long-term effects

Nature is a mad hacker programming like 90 going north.

I do not take anyone using the term "hacker" or hacking seriously.

The body kind of has IA, it learns. You got to love that analogy, the body or the mind is selflearned intelligence. And this portion of claims in your first post, is totally not true at all.

It is very true. You seem to get your information from other people that know next to nothing about how vaccines work, etc.

"These language/computer code/ "information" constraints that are foisted upon evolution include (but are definitely not limited to):

1. You cannot just rearrange what is there and get anything new
2. You cannot just copy-paste what is already there and get anything new
3. You cannot screw up the code/word and expect something new or good to come of it"

I think we can modify DNA quite a bit now, they are 15-20 years ahead of what they tell us.

If they don't tell us, how do you know? Are you a conspiracy theorist?

And you can sterilize with meds, and do other bad stuff, so you just study and isolate the counterresponse and find the DNA strain that combat it, and you can do it on a large scale.

Tell us more - how exactly is this done, and how do you know?
Because at this point, it seems to me that you are simply a paranoid conspiracy type.

And then you do trial and error on altering that genome strain, and finally you find the key.

If "THEY" know all about this and are 20 years ahead of what THEY say, why would THEY rely on trial and error?

Then you can test it in testtube babies. Then you can try it in meds to alter the strain in medtrials on people, and deprogram a protectionmechanism learned by the body. And of course they can see the limits of protection and test it's resistance. Then exceed it, and give killshots for that protection. This biowarfare is very much being researched.

You seem totally sane.

And you can mess with the XY chromosomes, and mess up genders.

Are you OK?
You're not planning to shoot up a school, are you?

You can as in registries on computers paste in sourcecodes that will create a DNA error code 404, and make disabled people. The creation of a life is fragile and defencemechanism not strong early on, evil people with much knowledge can destroy babies that have not grown fully in the womb.

Just so you know - I am just being entertained at this point. You seem very very gullible and paranoid and not very well informed.

And you kind of answer it yourself, 10 million B-cells, and 400blahblahblah T-cells, and communicating with receptors?

I never mentioned communicating, but in addition to you not understanding how vaccines work, you have also just admitted that you are 100% uninformed about cell biology, yet here you are, blabbering on about the subject.
Typical.

What if the communication link is broken? What if you make them occupied by emulating, and make them busy respnding to something else, while simultaniously infecting it with something stealthier, so it gets overlooked and alter?

What if? What if? What if the paranoid morons that you get your information from are just psychotic?

You aknowledge that medical science can produce smarter meds to fight diseases, making them respond to smaller threats as if it is an attack they must combat?

I did?

And that failed ones do not get that response, so there is a balance here between perceived threat and going unnoticed and harmless. So making a harmless threat make the body go into total panicmode, then giving it a less obvious housten we have a problem that is more dangerous and unknown will go undetected and uncombatted?

Take a stress pill dude. Your ranting is starting to worry me.

What is the big deal? We are all gods little smartphones walking around on earth and getting updated by him. I run on Goddroid version 8.756.777. How about you?

I run on reality-based software, not goofy paranoia and ignorance parading as knowledge.

I had initially thought you might be the sort of creationist that I could have a real discussion with, but you've shown yourself to be a loon.

Sorry, but you are clueless - about DNA, about how vaccines work, etc., and you are clearly immune to learning anything.

Good bye.

 

[Torah Keeper]

I never considered DNA to be identical to computer software. There are major differences. But the similarity of DNA to a software code is striking. And DNA is obviously the far more advanced technology. It is like a child's toy spaceship compared to the real spaceship.

I can't understand how atheists can look at the incredible information system in the design of DNA, and yet believe it just happened by chance. Even if a billion monkeys typed on computers for a billion years, they will not write the DNA code for a human being. It is statistically impossible.

You are talking about a code of 3 dimensional information stored on the nano scale, that self repairs, self replicates, removes and inserts data, compresses and unzips, has security checks, termination sequences to stop replication if too much data is corrupted, can be read forwards and backwards, adapts to environmental changes, and has multiple functions based on where and when it is read.

The code is so long even if you read it nonstop without blinking, it would take over four years for a person to just look at it all.

This is incredible and far more advanced than any computer. And we still don't know all about it.

DNA is very strong evidence of a designer. Truly we are fearfully and wonderfully made in the image of God.

 

[tas8831]

I never considered DNA to be identical to computer software.

Good, because it isn't.

There are major differences. But the similarity of DNA to a software code is striking. And DNA is obviously the far more advanced technology. It is like a child's toy spaceship compared to the real spaceship.

Your awe is noted, but is totally subjective.

I can't understand how atheists can look at the incredible information system in the design of DNA, and yet believe it just happened by chance.

Perhaps because we do not rely on the fallacy of begging the question or the strawman fallacy and do not engage in the argument via awe?

Even if a billion monkeys typed on computers for a billion years, they will not write the DNA code for a human being. It is statistically impossible.

Is it?
Please show the math that you employed in drawing that conclusion.

You are talking about a code of 3 dimensional information

3 dimensional? Explain.

stored on the nano scale, that self repairs, self replicates, removes and inserts data, compresses and unzips, has security checks, termination sequences to stop replication if too much data is corrupted, can be read forwards and backwards, adapts to environmental changes, and has multiple functions based on where and when it is read.

I see quite a bit of analogy and awe-based hyperbole there.
I am perplexed by much of it, but can you please explain the part I bolded, at least to start?

The code is so long even if you read it nonstop without blinking, it would take over four years for a person to just look at it all.

I see that you, too, do not understand what the phrase "genetic code" means. This is from a post I made on another forum on this subject:

For more detail, we can look at the page of the National Human Genome Research Institute - they would know, right?

The instructions in a gene that tell the cell how to make a specific protein. A, C, G, and T are the "letters" of the DNA code; they stand for the chemicals adenine (A), cytosine (C), guanine (G), and thymine (T), respectively, that make up the nucleotide bases of DNA. Each gene's code combines the four chemicals in various ways to spell out three-letter "words" that specify which amino acid is needed at every step in making a protein.​

Bolding mine.
Not that hard, right? The illustration they use at the NHGRI:

That ^^^ is the genetic code.

And yet, we see creationists use it in very.... non-standard ways. To avoid being accused of 'call outs' and such, I will provide no links and use no names, but if you think I am being unfair or dishonest, you can always use the forum search tool.
A few examples:

"Although we do observe elements of adapation [sic] and natural selection in flipping the switches on already existing genetic codes - we never see the creation of new genetic code that would allow one kind of animal to turn into another kind."

"the genetic code drives the makeup of the body, not the mind.
there isn't a genetic code for consciousness"

"Does our genetic code change over the course of our lives?"

" The introduction of new functional genetic code information into an organism rather than merely toggling the switches of the genetic code that is already there."

"You still have not given any arguments to support your claim that any of the things you listed (polyploidy, horizontal gene transfer, plasmids, VNTRs, endogenous retroviruses,) could be used to explain how the new genetic code required for reptilian style scales could be introduced by random chance into a cat and result in replacing their fur."

"Adaptation is using the information already in the genetic codes to express changes in an organism.

Evolution is the introduction of new information, new code, that allows for doing something that the organisms previous genetic code did not have the ability to express through epigenetic adaptation."​

Lots, lots more. But that is a nice sampling.

Seems like creationists conflate the actual "genetic code" with an organism's genes, or genome. Or something. This is among the many reasons it is hard to have real discussions with creationists - they conflate concepts/mis-define concepts/employ idiosyncratic definitions and expect others to use their fake ones/etc.

But hopefully they will learn,

In the end, there is really no need to 'read' the entire genome. So I am not sure what you think you are accomplishing with these factoids. Other than justifying your awe.

This is incredible and far more advanced than any computer. And we still don't know all about it.

We know a LOT about it.

DNA is very strong evidence of a designer.

Bare assertions are cool, but pretty childish.

Truly we are fearfully and wonderfully made in the image of God.

Truly, relying on such "arguments" may impress pew-warmers, but amongst educated adults, they just come off as pathetic.

But kudos for almost staying on topic!

 

[FrumiousBandersnatch]

I never considered DNA to be identical to computer software. There are major differences. But the similarity of DNA to a software code is striking. And DNA is obviously the far more advanced technology. It is like a child's toy spaceship compared to the real spaceship.

I can't understand how atheists can look at the incredible information system in the design of DNA, and yet believe it just happened by chance. Even if a billion monkeys typed on computers for a billion years, they will not write the DNA code for a human being. It is statistically impossible.

You are talking about a code of 3 dimensional information stored on the nano scale, that self repairs, self replicates, removes and inserts data, compresses and unzips, has security checks, termination sequences to stop replication if too much data is corrupted, can be read forwards and backwards, adapts to environmental changes, and has multiple functions based on where and when it is read.

The code is so long even if you read it nonstop without blinking, it would take over four years for a person to just look at it all.

This is incredible and far more advanced than any computer. And we still don't know all about it.

DNA is very strong evidence of a designer. Truly we are fearfully and wonderfully made in the image of God.

This kind of post amuses and frustrates me in equal measure - on the one hand DNA is said to be 'strikingly similar' to computer code and on the other, 'incredible and far more advanced' i.e. strikingly different. It's basically the argument from incredulity fallacy wrapped in a bad analogy.

Having qualifications and careers in both biology and software engineering, I can say from experience that while computer code may be the closest analogy we have for how DNA works, it is more misleading than it is useful.

 

[mindfulzen]

I am on about linguistics and such because that it what I started this thread for (for the most part). Analogies are fine, but they are not evidence, and many creationist use analogies as evidence because they do not understand the evidence.
Yes, I wrote as much in the OP:

When I used to teach Biology 101, I would use the classic English Language analogy when introducing students to DNA and Genetics.
Analogies are (or can be) good teaching tools to convey complex subjects to those who are unfamiliar with the subject matter, by making a comparison with that complex material and something more common and understandable.​

I also then explained why they fail above a certain level:

I was always sure to make it clear that this is pretty much where the analogy ends. I would explain that genes can be very different from sentences, that genomes, unlike books, contain lots of 'chapters' repeated over and over, or parts of them repeated, etc. But again, the analogy was good enough to get the basics across.​

And further what the relevance is to creationists and their antics:

It seems that many people never got that caution, and were apparently told, or it was implied, or they need it to be so that the analogy is almost exactly a 1-to-1 directly applicable comparison. And many of those same folks read a book or more likely an internet essay about "genetic information", where direct analogies - just as inapplicable as the language analogies - are employed in which it is asserted that genes/genomes are exactly like computer code, and subject to the exact same constraints.​

I do not get paid to teach creationists on an internet forum, and so will not waste the effort on people so affected by the Dunning-Kruger effect.
The creationists I encounter on these sorts of forums nearly ALWAYS present themselves as knowing all about it in the first place, despite the fact that most of them know next to nothing about it, and rely on the disinformation fed to them by their creationist heroes. I can usually tell after a sentence or two whether or not a creationist understands the things they pontificate about. Like when you wrote that vaccines change the DNA, I knew that you did understand how vaccines work.

That is false.
That is not programming the DNA.

I will need to see a reference for that. In the rest of the world, Covid-19 often produces long-term effects, some of which may be permanent.
COVID-19 (coronavirus): Long-term effects

I do not take anyone using the term "hacker" or hacking seriously.

It is very true. You seem to get your information from other people that know next to nothing about how vaccines work, etc.
If they don't tell us, how do you know? Are you a conspiracy theorist?


Tell us more - how exactly is this done, and how do you know?
Because at this point, it seems to me that you are simply a paranoid conspiracy type.


If "THEY" know all about this and are 20 years ahead of what THEY say, why would THEY rely on trial and error?

You seem totally sane.

Are you OK?
You're not planning to shoot up a school, are you?

Just so you know - I am just being entertained at this point. You seem very very gullible and paranoid and not very well informed.

I never mentioned communicating, but in addition to you not understanding how vaccines work, you have also just admitted that you are 100% uninformed about cell biology, yet here you are, blabbering on about the subject.
Typical.

What if? What if? What if the paranoid morons that you get your information from are just psychotic?

I did?

Take a stress pill dude. Your ranting is starting to worry me.

I run on reality-based software, not goofy paranoia and ignorance parading as knowledge.

I had initially thought you might be the sort of creationist that I could have a real discussion with, but you've shown yourself to be a loon.

Sorry, but you are clueless - about DNA, about how vaccines work, etc., and you are clearly immune to learning anything.

Good bye.

"I will need to see a reference for that. In the rest of the world, Covid-19 often produces long-term effects, some of which may be permanent."

I am just talking to you, I am not your mama. Search up BMI wordlwide, and lifeexpectancy. Scandinavians are pretty high on lifeexpectancy and at the most ideal range on BMI. Which is why can have universal healthcare, and the general goto example of the american left in discussions about healthcare. I do not know if you misread me, or deliberately misunderstood me to make a strawman, it was not related to health after covid. General healthcondition for our people. I do nott care about covid and log term effects, so pointless link. This is about DNA and programming. Your link may actually point to rewriting of DNA btw, if people permanently lose their senses, like smell and taste, and it carries on into the next generation. We will find out in 10 years.

"If they don't tell us, how do you know? Are you a conspiracy theorist?"

I assume that federal agencies are not dumb, and do have a headstart they keep secret to stay ahead of other nations researching the same tech or medical issue. That is how you keep the lead and stay competitive. Like big tech, slow rollout. What is being rolled out by big corporation with voiceapps, videoapps, etc, were developed like 5 years before released, and tinkered to perfection and released in the barbone, that they had updated to newer revisions time and again. That way they can release a revision if they get competition and kill the marketplace each time position is threatened. Just management and common sense really.

"You can as in registries on computers paste in sourcecodes that will create a DNA error code 404, and make disabled people. The creation of a life is fragile and defencemechanism not strong early on, evil people with much knowledge can destroy babies that have not grown fully in the womb."

This is a paste you made of my comment, before pasting your angry insult nr 20, instead of conversating about it, so pointless to paste your reply. Anyways, quick addon for those who read it, so they get it cleared up and have context. We do have a number of drugs that ppregnant women do not get to take, unless they must be taken to save the mothers life. Some drugs do result in autism, and other disabilities, like downs. Downs is a change of DNA by definition, it is altering the number of chromosomes, changing DNC into a new strain.So that is DNA programming, that can be researched and be the baselinestudy for bioengineering, if anybody wanted to make a jump in evolution, and start with human experimentation again. One could argue that Hitler did DNA engineering with lebensborn, putting up babymaking hospitals with what german scientists deemed superhuman women, and had them impreganated with the most athletic men in Germany, also deemed superhuman. Do that for some generations, and you program, get stronger people and better immunesystem. The williams sisters father has stated that he deliberately looked for a woman to make superathletes with, so they would become nr 1 in the world. Not sure if he is honest or not, but it worked out.

We have the same with former superathletes who have made babies with other superathletes, like Haaland at Dortmund, who played a game last night, and scored 2 goals and had 3 assist. Isn't it the same with Gio Reyna who also played there.

The rest of your nonsense is just anger, and frustration,so pointless to rewply to you. You got issues, and did not want a conversation on the topic. You wanted to make a speech, I get it. Opposing views were not welcome.You should point it out, if you just want to do a monologue, or just want people to opine if they agree with you.

 

[sfs]

Having qualifications and careers in both biology and software engineering, I can say from experience that while computer code may be the closest analogy we have for how DNA works, it is more misleading than it is useful.

As someone who writes code to study genetics for a living (my job title is 'senior computational scientist')... yeah. To the extent that genetics does resemble software, it resembles software that wasn't designed, that is riddled with redundancies, unused, dead code, patches to repair earlier bugs, and multiple modules doing similar things that look like they were written by different people.

 

[FrumiousBandersnatch]

As someone who writes code to study genetics for a living (my job title is 'senior computational scientist')... yeah. To the extent that genetics does resemble software, it resembles software that wasn't designed, that is riddled with redundancies, unused, dead code, patches to repair earlier bugs, and multiple modules doing similar things that look like they were written by different people.

Quite - but mostly it doesn't resemble any recognisable computer software...

 

[Tinker Grey]

ATTTAGACATTTAGATTATTAGGAGGGGGAAAAACCCCATCATCATCATCTTAGCTAGCATGCATGCATGCTAGCTAGTAGCTAGCTGACTG

{v for k,v in d.items if k in ['a', 1, 2, 'b']}

The only similarity is that the uselessness of either is indeterminate.

 

[SelfSim]

Computers are the implementation of the rules of digital logic.
Redundacies and exceptions in the genetic code, are demonstrations of non compliance with those rules.
Logic is associated only with rationally thinking, intelligent humans.
The genetic code is therefore not a product of intelligence.