A comparison of human genetic code with the genetic code of other primates

samiam · Jun 30, 2005

Let's look at a section of the genetic code for humans and some primates:

Code:

Human      AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGC
Chimp                      A T  C                 A               T
Gorilla                      TG    T     T        A        A      T
Ora                        AC  CC     G  T     T  A  C        CC    G
Lemur              TA  A   AC      A        A  T   C       A  CA  T

In this chart, only the parts of the genetic sequence that differ between human and other primates are listed for non-humans. As we can see, the human is remarkably a lot like a chimp, a little less like a gorilla, even less like a Orangutan, and yet even less like a Lemur. What is the chance of this level of similarity from random chance alone?

There are four non-human species here. One differs in five codons, one in seven codons, one in 12 codons, and one in 13 codons. Doing some hairy math, we get the following table:

Code:

Codon difference           Chance of happening
5                          1 in 43584035141688932777068455669
7                          1 in 33433107027157641303274312
12                         1 in 6175725839354732886
13                         1 in 385982864959670805

So, the chances of all five animals having, by chance, this amount of codon difference is one in 3473443252963481966956495750331838528924011681856948698678902255299509633288176663138891440

This number is roughly 2 ^ 301

This shows beyond any reasonable doubt that the human species is genetically related to the Chimpanzee and other primates, and that the chance of our genetic code being similar to these other species because of random chance is, for all intents and purposes, zero.

235U92 · Jun 30, 2005

I'm not quite sure if you're arguing against evolution. But since when is evolution just random chance? The only thing random about evolution are the mutations that occur. Natural selection is completely non-random.

Dr.GH · Jun 30, 2005

Well, let me antisipate some questions:

Why that segment?

How does that segment compare to any other randonly selected segment of equal length and equal genetic relevance?

I think you might have a good start for a evo/creto article of some merit, but a bit more detail and some more work is needed.

What are the contrasts between coding and noncoding regions, particularly bring in endogenous retroviral fragments ie:

Welkin E. Johnson and John M. Coffin,
1999 "Constructing primate phylogenies from ancient retrovirus sequences" PNAS Vol. 96, Issue 18, 10254-10260, August 31,

Heui-Soo Kim, Osamu Takenaka and Timothy J. Crow
1999 "Isolation and phylogeny of endogenous retrovirus sequences belonging to the HERV-W family in primates" Journal of General Virology (1999), 80, 2613-2619

John Hawks, Keith Hunley, Sang-Hee Lee and Milford Wolpoff
2000 "Population Bottlenecks and Pleistocene Human Evolution" Molecular Biology and Evolution 17:2-22 (2000)

mikeynov · Jun 30, 2005

235U92 said:
I'm not quite sure if you're arguing against evolution. But since when is evolution just random chance? The only thing random about evolution are the mutations that occur. Natural selection is completely non-random.

He's saying the opposite, actually. That genetic comparisons show that the groupings of similarities makes "random chance" an inviable explanation.

However, theists generally claim divine design. With the added bonus (for them) of not actually being able to test that assertion.

235U92 · Jun 30, 2005

mikeynov said:
He's saying the opposite, actually. That genetic comparisons show that the groupings of similarities makes "random chance" an inviable explanation.

However, theists generally claim design intent. With the added bonus (for them) of not actually being able to test that assertion.

Ah... wait. So he's arguing for Intelligent Design of some sort?

mikeynov · Jun 30, 2005

235U92 said:
Ah... wait. So he's arguing for Intelligent Design of some sort?

No

He appears to be arguing for common ancestry. In short, he's suggesting evolution is true.

I was just commenting that theist anti-evolutionists would probably respond to an argument like this by saying "well God wanted it that way." Which, of course, doesn't explain anything at all, and is certainly not scientific.

samiam · Jun 30, 2005

We very genetically similar to other primates. This makes (or has made) some creationists a little jittery, e.g:

http://www.harunyahya.com/ramadan_pages_day28.php
http://members.cox.net/ardipithecus/evol/HovindLie.html
http://members.aol.com/dwise1/cre_ev/bullfrog.html

- Sam

235U92 · Jun 30, 2005

mikeynov said:
No

He appears to be arguing for common ancestry. In short, he's suggesting evolution is true.

I was just commenting that theist anti-evolutionists would probably respond to an argument like this by saying "well God wanted it that way." Which, of course, doesn't explain anything at all, and is certainly not scientific.

Bah. I are confused. :scratch:

It sounded like he was arguing against it and saying it was just "random chance", which it is not.

This is what I get for being somewhat new to evolutionary biology.

Praxiteles · Jun 30, 2005

235U92 said:
Bah. I are confused.

It sounded like he was arguing against it and saying it was just "random chance", which it is not.

This is what I get for being somewhat new to evolutionary biology.

Pheh.

At 19, you're still just somewhat new, full stop.

Praxiteles · Jun 30, 2005

samiam said:
We very genetically similar to other primates. This makes (or has made) some creationists a little jittery, e.g:

http://www.harunyahya.com/ramadan_pages_day28.php
http://members.cox.net/ardipithecus/evol/HovindLie.html
http://members.aol.com/dwise1/cre_ev/bullfrog.html

- Sam

Well, yes and no.

YECists have a pat (if unscientific) answer to that, being common designer. They argue that the common designer simply used similar DNA were it was applicable to species that just so happen to look similar.

235U92 · Jun 30, 2005

Praxiteles said:
Pheh.

At 19, you're still just somewhat new, full stop.

<_< I was talking about biology.

Dr.GH · Jul 1, 2005

235U92 said:
<_< I was talking about biology.

Not to worry.

Actually, natural selection is not "random" in the common meaning of the word. Mutations are not "random" in the common meaning of the word. So, evolutionary theory is not "random" in the common meaning of the word.

Justin Horne · Jul 1, 2005

I'd also be curious, in the end result, to see the amino acid differences by the codon mutations. You'd go farther and make more of a point by determining that even after x difference in ATCG, the % of silent mutations.

bafoofkit · Jul 1, 2005

Of course evolution is true. That is the ONLY viable option for life.

Dr.GH · Jul 1, 2005

Justin Horne said:
I'd also be curious, in the end result, to see the amino acid differences by the codon mutations. You'd go farther and make more of a point by determining that even after x difference in ATCG, the % of silent mutations.

Good point. If I were not tired, I would wwork it out assuming that the start of the sequence is the start of a coding section, but what if it is a hox gene, or a noncoding ERVF? That is what I am to tired to look up.

So come on, samiam, full references please!

Praxiteles · Jul 1, 2005

samiam is arguing for common ancestry, not agin it.

Justin Horne · Jul 1, 2005

I'll try to do it, gimme a bit, I'm tired too, and I haven't actually worked it out in a while...I was trying o do it in my head a few seconds, now its pencil and paper time...

samiam · Jul 1, 2005

So come on, samiam, full references please!

I think this sequence comes from here:

Hasegawa, M and H. Kishino. 1989. Confidence limits on the maximum-likelihood estimate of the hominoid tree from mitochondrial-DNA sequences. Evolution 43: 627-677.

Or possibly from:

Kishino, H. and M. Hasegawa. 1989. Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in Hominoidea. Journal of Molecular Evolution 29:170-179.

Some of the sequence can be seen here:

http://bio.fsu.edu/~stevet/BSC5936/Wilgenbusch.2003.pdf

And, oh, the source I got this chart from (it was not a biology class, but an aside in a Linguistics class, which is why I'm a bit hazy on the details) said that the sequences were mitochondrial sequences.

Not that it much matters; these sequences conclude that we are primates, and are more like monkeys than your average joe on the street would like to admit. Even if the rest of our genome was different from the Chimp's genome (which it isn't, of course), the fact that these two isolated sequences are so similiar would prove that we share genetic code with them.

- Sam

Justin Horne · Jul 1, 2005

Allright.. my mind is tired of a,u,g,u,.... regardless...

Assuming the first codon list is 5'--->3' you get this encoded:
UUCGAAGUGGCCGCGUCAGUAAGAGUAUUAGCGGGUGCCCGAAUGUAGGAGUAAUGAUAAGACG

At least you should, I'm tired.
The only aug is near the end... Assuming the original list is 3'--->5' it would place it near the beginning, which would give you a long list of amino acids to check...
That's all for now folks.

235U92 · Jul 1, 2005

Dr.GH said:
Not to worry.

Actually, natural selection is not "random" in the common meaning of the word. Mutations are not "random" in the common meaning of the word. So, evolutionary theory is not "random" in the common meaning of the word.

I never said Natural Selection was random, I said it was "completely non-random". But what do you mean about mutations not being random in the normal sense? Although not new to science, I'm somewhat new to the advanced workings of evolution, so any information would be helpful. Thanks.

A comparison of human genetic code with the genetic code of other primates

Active Member

Active Member

Doc WinAce fan

Senior Veteran

Active Member

Senior Veteran

Active Member

Active Member

PraxAce

PraxAce

Active Member

Doc WinAce fan

Senior Member

Active Member

Doc WinAce fan

PraxAce

Senior Member

Active Member

Senior Member

Active Member

Similar threads