Misdirection in Claim of 97% DNA match in Humans, Chimps

[Nazaroo]

I would add this 'error', or rather deliberate fraud to the long list of Evolutionist self-delusions, but it deserves its own thread as stunning example
of how propaganda is manufactured for deliberate effect.

The normal use of percentages to express similarity,
even estimates and guesstimates,
does not involve extra layers of sophisticated
misdirection or fakery.

If a man says 'these two objects are 50% the same,
the meaning is transparently clear.
Half the features, components, arrangement, and/or surface
will be essentially identical.

In fact IQ tests abound with such tests,
which require the reader to make the correct interpretation
of a phrase and usage of the percentage sign.

Looking at the picture below, the viewer has no problem
identifying the two meals as 100% identical, except for the plate:

The field of Genetics is no exception to normal English usage,
or at least it shouldn't be, and most of the time it hasn't been,
...until recently.

For example, we are told:

"We share 1/2 of our genetic material with our mother
and 1/2 with our father. We also share 1/2 of our DNA,
on average, with our brothers and sisters. Identical twins
are an exception to this rule. They share their entire DNA between them."
​

And would be immediately expressed in percentage terms as:

"We share 50% of our genetic material with our mother
and 50% with our father. We also share 50% of our DNA,
on average, with our brothers and sisters. Identical twins
are an exception to this rule. They share their entire DNA between them."
​

There is no special lingo needed, no misdirection intended,
no confusion of meaning possible, and the geneticist has no need
of special qualifiers, or technical jargon, to describe the situation.

But having viewed the above statement, which in light of genetic laws
of inheritance is not just clear but obvious and accurate,
the reader will immediately become aware of a huge problem
in the use of the very same language and expression in the claim below:

Who can help but notice that if the claim about parents and siblings is true,
the statement about chimpanzees must be on the face of it FALSE.

How can anyone share more DNA with a monkey than with their own parents?

Of course the answer is in the fact that the Evolutionists have deliberately
misled us by moving the goalposts once again.

It will be no mystery to discover the Evolutionists
have taken very sophisticated and heavily qualified statements
by geneticists, and twisted them around, creating total BS.

 

[Nazaroo]

"a brother might share 52% of his DNA with one sibling and 47% with another sibling." (wiki ISOGG)

These percentages are naturally absolute terms, and entirely reversible in expression,
the differences and matches adding up to a total of 100%:

" For example, your first cousin has 12.5% of the genes you do (implying, inversely, that 87.5% of their genes are different)." (Kennon)

In the light of this obvious fraud,
it will hardly be a surprise to find
that the Evolutionist apologists
can't even keep their own numbers straight:

Thus we have:

"Humans share over 90% of their DNA with their primate cousins. " (Science Daily)

Chimpanzee 98% shared DNA with humans. (NAS Science Museum)

"Humans, for example, share 99.6% of their DNA with chimpanzees." (Life Science)

"Chimps, Humans 96% the same:
A comparison of Clint's genetic blueprints with that of the human genome shows that our closest living relatives share 96 percent of our DNA." (Nat. Geographic News)

And let us not think that these propagandists do not mean to mislead us:
What can they possibly intend the reader to understand, when they
say things like this:

"If genetic code is a book, what we found is that entire pages of the book duplicated in one species but not the other," said Eichler. (Nat. Geographic News)
​

But wait... Evolutionists themselves have supposedly tried to correct the excesses,
back as early as 2003:

"A new report in the Proceedings of the National Academy of Sciences suggests that the common value of >98% similarity of DNA between chimp and humans is incorrect.1 Roy Britten, author of the study, puts the figure at about 95% when insertions and deletions are included. Importantly, there is much more to these studies than people realize." (AnswersInGenesis)
​

Did we get that right? ..insertions? ...deletions? what do they mean?

Quote:
The >98.5% similarity has been misleading because it depends on what is being compared.

Say what?

No Kidding Sherlock.
You mean they haven't been exactly straight with us on what they are measuring?


Quote:
There are a number of significant differences that are difficult to quantify. A review by Gagneux and Varki2 described a list of genetic differences between humans and the great apes. The differences include ‘cytogenetic differences, differences in the type and number of repetitive genomic DNA and transposable elements, abundance and distribution of endogenous retroviruses, the presence and extent of allelic polymorphisms, specific gene inactivation events, gene sequence differences, gene duplications, single nucleotide polymorphisms, gene expression differences, and messenger RNA splicing variations.’2
Specific examples of these differences include:

1. Humans have 23 pairs of chromosomes while chimpanzees have 24. Evolutionary scientists believe that one of the human chromosomes has been formed through the fusion of two small chromosomes in the chimp instead of an intrinsic difference resulting from a separate creation.
2. At the end of each chromosome is a string of repeating DNA sequences called a telomere. Chimpanzees and other apes have about 23 kilobases (a kilobase is 1,000 base pairs of DNA) of repeats. Humans are unique among primates with much shorter telomeres only 10 kilobases long.3
3. While 18 pairs of chromosomes are ‘virtually identical’, chromosomes 4, 9 and 12 show evidence of being ‘remodeled.’4 In other words, the genes and markers on these chromosomes are not in the same order in the human and chimpanzee. Instead of ‘being remodeled’ as the evolutionists suggest, these could, logically, also be intrinsic differences because of a separate creation.
4. The Y chromosome in particular is of a different size and has many markers that do not line up between the human and chimpanzee.5
5. Scientists have prepared a human-chimpanzee comparative clone map of chromosome 21 in particular. They observed ‘large, non-random regions of difference between the two genomes.’ They found a number of regions that ‘might correspond to insertions that are specific to the human lineage.’6

These types of differences are not generally included in calculations of percent DNA similarity.


Wait, they left out many significant and already well-known differences,
when "calculating" the differences?


WTHeck?



Quote:
In one of the most extensive studies comparing human and chimp DNA,6 the researchers compared >19.8 million bases.
While this sounds like a lot, it still represents slightly less than 1% of the genome.
Wait wait wait...


They only actually compared less than 1% of the DNA?


Quote:

They calculated a mean identity of 98.77% or 1.23% differences. However, this, like other studies only considered substitutions and did not take insertions or deletions into account as the new study by Britten did. A nucleotide substitution is a mutation where one base (A, G, C, or T) is replaced with another. An insertion or deletion (indel) is found where there are nucleotides missing when two sequences are compared.

Figure 1. Comparison between a base substitution and an insertion/deletion. Two DNA sequences can be compared. If there is a difference in the nucleotides (an A instead of a G) this is a substitution. In contrast, if there is a nucleotide base which is missing it is considered an insertion/deletion. It is assumed that a nucleotide has been inserted into one of the sequences or one has been deleted from the other. It is often too difficult to determine whether the difference is a result of an insertion or a deletion and thus it is called an ‘indel’. Indels can be of virtually any length.

The Britten1 study looked at 779 kilobase pairs to carefully examine differences between chimpanzees and humans. He found that 1.4% of the bases had been substituted, which was in agreement with previous studies (98.6% similarity). However, he found a much larger number of indels. Most of these were only 1 to 4 nucleotides in length, although there were a few that were > 1000 base pairs long. Surprisingly, the indels added an additional 3.4 % of base pairs that were different.
While previous studies have focused on base substitutions, they have missed perhaps the greatest contribution to the genetic differences between chimps and humans. Missing nucleotides from one or the other appear to account for more than twice the number of substituted nucleotides. Although the number of substitutions is about ten times higher than the number of indels, the number of nucleotides involved in indels is greater. These indels were reported to be equally represented in the chimp and human sequences. Therefore, the insertions or deletions were not occurring only in the chimp or only in the human and could also be interpreted as intrinsic differences.
Will evolution be called into question now that the similarity of chimpanzee and human DNA has been reduced from >98.5% to ~95%? Probably not. Regardless of whether the similarity was reduced even below 90%, evolutionists would still believe that humans and apes shared a common ancestor.

Can you say 'scientism fraud'?

 

[Nazaroo]

What we learn when we dig deeper into the sloppy use of language
by Evolutionist propagandists, is that they are using the expressions,
"DNA" and "Genes" interchangeably, even though they know these
items are NOT interchangeable.

When an Evolutionist says "96% of DNA is shared",
what they really mean is that "96% of GENES appear to be shared.".

The causal reader may at first glance say,
"I don't get it: Whats the difference there?
I'm not following you here..."

The answer is actually rather simple.
Currently biologists make a distinction between several different types of DNA,
segments which are defined by their presumed 'function' (or non-function):
Thus we have:

(1) Genes: segments of DNA that are known to do something, like code proteins.
(2) Regulating DNA: coded DNA that regulates Genes and other segments, turning them on and off, and coordinating their actions.
(3) Uncoded DNA segments: whose function is unknown, and often presumed non-functional.
(4) Repetative DNA: DNA which seems to be just repeating patterns, possibly only encoding the beginning or ending of a sequence, like book-ends.
(5) "Junk-DNA": segments of DNA which are almost certainly either meaningless or broken, such as portions that formerly allowed a creature to make Vitamin C, or segments of crap inserted by a virus.
​

When comparing Humans and Chimps in the past, scientists concentrated on already identified Genes,
segments of DNA which were known to encode proteins and similar molecules.
Protein-Encoding DNA however,
only includes about 1% of our DNA:

In fact, the Human Genome can be broken down according to current knowledge,
by category as follows:

In the above pie-chart, the large light-blue-green section
represents NON-coding DNA, as far as is known.

Another more detailed breakdown of percentages is as follows:

Several types of DNA segments have already been identified
as no longer being 'junk'-DNA or 'uncoded-DNA', but are now
known to be regulating-DNA which functions to oversee layout
and specialization of cells in an individual.

We don't need to delve into the controversy of "Junk-DNA"
to understand that we are only gradually understanding the
purpose(s) of various segments of DNA in the Human Genome.

Although DNA previously thought to be "Junk" has been found to have
interesting regulatory functions, the total amount of DNA classed as
"Uncoded-DNA" is still very substantial, and we are not likely to
be able to map the functions of the bulk of "Uncoded-DNA" very soon.
Because of this, a better name than "uncoded-DNA" might be
"Not Yet Understood- DNA".

In discussing the sharing of DNA between Man and Chimp,
Identifiable Genes were what was focused on,
and it was assumed that most of the DNA in the Genome was
'uncoded DNA', that is, DNA without a function, and which
had presumably accumulated like a junk-yard through the process of evolution.

It is known that viruses can insert malicious or 'junk-DNA' into chromosomes,
and much of the differences found between species in the 'uncoded-DNA' region
was assumed to have been caused by either random mutation (transposition, insertion),
or by viral infection.

Because biologists already had a presupposed theory for differences in the
'uncoded-DNA' region, those differences could be safely ignored when
comparing Human and Chimp DNA.

 

[Nazaroo]

Getting back to the typical charts used to sell Man's descent from early apes (hominids),

We must now note the glaring problem in interpreting the percentages shoved in our face.

If Man shares 25%-50% of his DNA with fruitflies and yeast,
then about that amount must be ignored when discussing the question
of Man's relation to early Apes.

98% now becomes something more along the lines of 35-48%
of DNA code which might be claimed as significant to the question of Common Descent from early Apes.

This 35-48% must be further trimmed by another 10% for generalized
mammalian code and perhaps another 20% for regulatory coding that
will be common to all species of animal and even plant.

We are looking at a residual 10-15% of DNA coding that might be
useable as some kind of evidence of common descent.

As the latest investigations conclude, even this much genetic overlap
may be of little significance at all, because the bulk of physical features
that define speciation are not controlled by normal Genes, but rather
by the 'regulatory-DNA' which has been unappreciated hitherto:

Quote:


'Junk DNA' Defines Differences Between Humans and Chimps

...
"The research team lead by Georgia Tech Professor of Biology
John McDonald has verified that while the DNA sequence of genes
between humans and chimpanzees is nearly identical,
there are large genomic "gaps" in areas adjacent to genes
that can affect the extent to which genes are "turned on" and "turned off."



The research shows that these genomic "gaps" between the two species
are predominantly due to the insertion or deletion (INDEL) of viral-like
sequences called retrotransposons that are known to comprise about
half of the genomes of both species. The findings are reported in
the most recent issue of the online, open-access journal Mobile DNA.'

"These genetic gaps have primarily been caused by the activity of
retroviral-like transposable element sequences," said McDonald.
"Transposable elements were once considered 'junk DNA'
with little or no function. Now it appears that they may be
one of the major reasons why we are so different from chimpanzees."

That is, genetic biologists have discovered that speciation is
primarily caused by the areas of DNA previously ignored.

The actual differences between Man and Chimps in respect of
gross, raw or bulk DNA is of little significance to speciation,
and therefore of little significance for Common Descent.

What matters is the OTHER, regulatory codes controlling morphology,
and these are significantly NOT LIMITED to raw DNA sequences,
but are also encoded in the ARRANGEMENTS of code segments.

This is an astounding and exciting finding,
which goes entirely against the parading of
fudged percentages of similarity for raw DNA content.



Look again at the following chart (in particular, section B):

Over 20% of Human DNA is now known to be made up of Regulatory Sequences,
which are now acknowledged to control physical layout, features, proportions, and general speciation.
These were formerly thought to be 'junk DNA' or 'uncoded DNA'.

If a significant portion of this 20% is now known to be the main source of
the differentiation between Man and Chimps,
then the claim that Man and Chimp share 98% of DNA is total nonsense.

 

[Nazaroo]

Curious Windowshopper: Are these real gold coins?

Evolutionist Jeweller: Sure. They are 99.9% gold.

Curious Windowshopper: Really? how many did you test?

Evolutionist Jeweller: Just one. Thats all you need, to know they are real.

Curious Windowshopper: ... So, which one did you test? I'll buy that one.

Evolutionist Jeweller: Sorry, I don't know. I put it back with the others.

Curious Windowshopper: Um... I think I'll come back later.

Quote:
...The above examples demonstrate that the conclusions of scientific investigations
can be different depending on how the study is done. Humans and chimps
can have 95% or >98.5% similar DNA
depending on which nucleotides are counted and which are excluded.

Modern humans can have a single recent ancestor <10,000 or 100,000-200,000 years ago
depending on whether a relationship with chimpanzees is assumed
and which types of mutations are considered.

Greater Than 98% Chimp/Human DNA Similarity? Not Any More. - Answers in Genesis

Get a Clue:


(1) Professor Plum was murdered in the Kitchen with a Knife.

(2) Kernel Mustard was murdered in the Livingroom with a Gun.

...depending upon which possibilities you want to include or exclude.

 

[Nazaroo]

Humans, Chimpanzees and Monkeys Share DNA
but Not Gene Regulatory Mechanisms

Nov. 6, 2012

... Dr. Gilad reported that up to 40% of the differences in the expression or activity patterns of genes between humans, chimpanzees and rhesus monkeys can be explained by regulatory mechanisms that determine whether and how a gene's recipe for a protein is transcribed to the RNA molecule that carries the recipe instructions to the sites in cells where proteins are manufactured.


In addition to improving scientific understanding of the uniqueness of humans, studies such as the investigation conducted by Dr. Gilad and colleagues could have relevance to human health and disease.
"Through inter-species' comparisons at the DNA sequence and expression levels, we hope to identify the genetic basis of human specific traits and in particular the genetic variations underlying the higher susceptibility to certain diseases such as malaria and cancer in humans than in non-human primates," said Dr. Gilad.


Dr. Gilad and his colleagues studied gene expression in lymphoblastoid cell lines, laboratory cultures of immortalized white blood cells, from eight humans, eight chimpanzees and eight rhesus monkeys.
They found that the distinct gene expression patterns of the three species can be explained by corresponding changes in genetic and epigenetic regulatory mechanisms that determine when and how a gene's DNA code is transcribed to a messenger RNA (mRNA) molecule.


Dr. Gilad also determined that the epigenetics process known as histone modification also differs in the three species. The presence of histone marks during gene transcription indicates that the process is being prevented or modified.
"These data allowed us to identify both conserved and species-specific enhancer and repressor regulatory elements, as well as characterize similarities and differences across species in transcription factor binding to these regulatory elements," Dr. Gilad said.


Among the similarities among the three species were the promoter regions of DNA that initiated transcription of a particular gene.
In all three species, Dr. Gilad's lab found that transcription factor binding and histone modifications were identical in over 67% of regulatory elements in DNA segments that are regarded as promoter regions.

A simple moment of reflection shows that if about 67-70% of regulatory elements (DNA) are identical,
then about 30-33% of them are different.

If Regulatory elements comprise about 20% of human DNA,
then about 13.4% of that is identical,
leaving about 6.6 % of the Genome in this area DIFFERENT.

Adding that 6.6% to the 4% of protein encoding genes admitted to be different, we have actually about

10.6% of Human DNA now known to differ from that of chimps.

This leaves possibly identical DNA at less than 89%, not the 96% claimed,
which was based on a 1% sample of protein encoding genes.

 

[Subduction Zone]

Too long didn't read.

Yes, there are different ways to measure the differences. But when we use the method that gives us a difference using shared DNA we see that we are closest to the animals that we had the closest common ancestor with. In other words, shared DNA supports the theory of evolution.

There is no dishonesty, the only dishonesty I saw was by the OP when he tried comparing sharing chromosomes to sharing DNA.

 

[Nazaroo]

Well, lets see what others have said on the same subject:

Quote:
says animal geneticist Professor Chris Moran from the University of Sydney's Faculty of Veterinary Science.

"Making broad comparisons by saying … 98 per cent of [human] genes are similar to a chimpanzee or whatever else … tend to be a little bit misleading," says Moran.
The amount of genetic material we share with other species depends upon what you compare.

All living organisms have genetic information encoded in deoxyribonucleic acid (DNA), divided into units called genes. Information is transferred from the genes via a chemical called ribonucleic acid (RNA). Some RNA is translated into chains of amino-acid that make up proteins, the building blocks of every living cell.

Scientists have discovered about 20,000 mammalian genes that encode proteins with similar basic functions.

So if you compare the protein-encoding portion of our DNA we have a lot in common with a lot of mammals.

"Mammals have most of the same genes for similar biochemical and physiological functions. If you look at the details of the genes … there'll be differences between them, but they'll still be doing the same kind of function," says Moran.

"It's a little bit like having a Ford or a Holden — it's still obviously a car but a slightly different version."

But while 20,000 similar genes sounds like a lot, only one to two per cent of our DNA actually encodes proteins. Most of the rest is transcribed into RNA.


Evolutionary differences

Parts of the genome that don't encode proteins tend to evolve rapidly, so you can have significant regions of the genome where there's no discernible similarity between species, says Moran. This means many sequences will not line up when you compare genomes between species.
And the further away two species are on the evolutionary tree, the greater the difference.


"If we compare really closely related species, like a human and chimpanzee, we can still see the similarity between these rapidly changing sequences.

If you move further away to the more distantly related pig, so many changes in the DNA will have occurred that it is no longer possible to recognize that the sequences were ever similar.

So when we see Evolutionists playing fast and loose with words,
confusing "similar" and "identical",
we see he is only copying what other propagandists do,
in obscuring the two completely different meanings.

Human and Chimp DNA is NOT 96% IDENTICAL,
and the percentage is NOT based on checking the entire Humane Genome.

Human and Chimp DNA is an estimated 96% SIMILAR,
and the percentage is based on checking ABOUT 1% of the Human Genome.

 

[Nazaroo]

When we delve into the details of how guesstimates of a match are made,
in trying to measure the similarity of DNA, we can get some insight into the
computational problem by a look at various proposed methodologies:

Quote:
Re: Genetic similarity between species

by xcthulhu on June 24th, 2011, 1:05 pm

Lincoln wrote:I saw a graphic which compared the genome for humans and rats. The same genetic code (substantially) was in both species, but outrageously scrambled at the genome level. With few exceptions, what I saw was typified by (for example) human chromosome #1, which was blasted over most of the rat chromosomes.
​

Well, according to these lectures from 2009, it looks like the results of MSA depend on one's choice of initial sequences, which appears to be dependent on application.
Aligning entire genomes seems to boil down to a lot of subjective decisions on the part of the investigator.
If you broke the human genome down into sequences coding for proteins (i.e., initial segments starting with codons), it makes sense that you'd see the human genome spattered about the rat genome. If you broke the problem down in terms of entire chromosomes, like in Para's picture way back of humans v. chimps, then you probably won't see this spattering you're talking about.

If you made your fundamental unit singular base pairs, I suppose alignment would be 100%.

Lincoln wrote:I'm guessing they first identify and align the relevant chunks of DNA and then do a base-pair comparison, finding 30% overlap. 30% overlap will make the alignment pretty easy, given that we're talking so many base pairs.
​

That makes more sense than my "codons aligned / total codons" suggestion.

Still, how you align sequences isn't universal like I said. What's "relevant chunks" is key. So the human v. banana 30% calculation probably boils down to the question of how you slice bananas and humans so you can compare the pieces.

Seems to me that Occam's razor/computational concerns dictate that a course grained, chromosomal comparison is the best route for a lay person who is stupid at biology and doesn't have a super computer (ie, yours truly).

To give some idea of the historical development of the methods of comparing DNA across species, the following US Govt. chart and
explanation is enlightening:

Quote:

[SIZE=-1]Of mice and men.

The genetic similarity (or homology) of superficially dissimilar species is amply demonstrated here. The full complement of human chromosomes can be cut, schematically at least, into about 150 pieces (only about 100 are large enough to appear in this illustration), then reassembled into a reasonable approximation of the mouse genome.
The colors of the mouse chromosomes and the numbers alongside indicate the human chromosomes containing homologous segments. This piecewise similarity between the mouse and human genomes means that insights into mouse genetics are likely to illuminate human genetics as well.

[/SIZE]

It is obvious that these crude methods, naive attempts to 'match'
the literally billions of sequences that make up an animal's DNA,
are trivially inaccurate and quite open to abuse by propogandists
on all fronts.

 

[Nazaroo]

So when we are told that:

"Humans share 92% of their DNA with Mice."
​

We can tell by the actual picture of the 'reconstruction'
that we are simply not being told the whole story.

The actual gymnastics that Evolutionists have had to go to,
to achieve a "92% match" is astounding, not for its innovation,
but for its basic dishonesty.

For several things are being misrepresented here,
and it is not accidental:

(1) The alleged 'matches' are not 100% identical matches,
but began as guesses based on dying chromosomes by color, in an attempt to identify similar segments. Now computer runs look for about a 30% target match before
jumping to the next DNA segment, to save computing time over the ominously
large calculation problem.

(2) The drastic rearrangement of the chromosome material is entirely discounted
in assessing similarity of content, and also most importantly, similarity of function.

(3) The use of language continues to be dishonest when dealing with the public.
When geneticists say something like "96% similar" they are deliberately
avoiding a more precise language, such as "96% IDENTICAL", because
they know damn well these portions for which they have formed a 'match'
ARE NOT IDENTICAL AT ALL, but are categorized as "Similar" on the basis
of a 30% internal local match in nucleotide sequencing.

That's right.
A DNA segment is called a 'match' if it aligns with 30% of its target.

If we suppose (applying a reasonably sceptical methodology)
that the remaining 70% of the segment has a (generous) 25% match
over four nucleotides possible, then as much as 52.5% of the material 'matched' could actually vary in detailed content and pattern.

That drops the 96% down to a whoppingly low 43.5% match
between Human and Chimp over the entire Genome.

 

[Nazaroo]

Computer runs are easy things to set up and estimate, providing you have the data in convenient form and some useful search algorithms:

Quote:
open source sequence alignment systems, and wikipedia has an enormous list:
http://en.wikipedia.org/wiki/List_of_se ... t_software

It's a bit of a pity that they don't list the licenses for everything, since I think this is a good job for open source software.

Wading through a little, I found the following open source projects in that list:

• BAli-Phy - BAli-Phy: Welcome!
• Clustal - Clustal Omega, ClustalW and ClustalX Multiple Sequence Alignment
• FSA - FSA: Fast Statistical Alignment
• MSAProbs - MSAProbs - Parallel and accurate multiple sequence alignment
• UGENE - UGENE - Integrated Bioinformatics Tools

Now, an alignment between two genomes is a slick thing to compute, but I don't understand exactly how an alignment between humans and bananas yields "30%". What is this percentage of? I suspect this means : codons aligned / total codons But my gut doesn't know bioinformatics, obviously. Para, you gave the "30%" number ...how is it computed?

Finally, there are around 60 genomes in the following database: ftp://ftp.ncbi.nih.gov/genomes/

To compute optimal alignments between all of these genomes will take approximately 602/2 = 2400 jobs (proof - the number of comparisons is given by an arithmetic series). Each MSA job is hard according to complexity theory (wikipedia says the MSA problem is NP-complete) so I would expect each job to take a minute (or worse). But each job is completely independent so distributing everything is simple in principle - if Lincoln has a farm of computers that run ssh and can execute shell scripts (or hadoop...) then he can do the whole thing pretty quickly. Otherwise it will require around two to three days on a single computer.

But as people have already observed, you have to select DNA segment sizes that are going to be meaningful.

 

[Nazaroo]

Say What!?!

 

[Nazaroo]

Wonders of Science:

 

[Nazaroo]

 

[Nazaroo]

 

[Nazaroo]

 

[Loudmouth]

species A: AATATTTATATT--GGAATTT
species B: AATATTTACATTCTGGAATTT

According to you, how should the scientific community report the similarity between these two species at the DNA level?

 

[cf123]

How can anyone share more DNA with a monkey than with their own parents?

Of course the answer is in the fact that the Evolutionists have deliberately
misled us by moving the goalposts once again.
[/COLOR][/B][/SIZE]
It will be no mystery to discover the Evolutionists
have taken very sophisticated and heavily qualified statements
by geneticists, and twisted them around, creating total BS.

youve totally misunderstood the science.

50% of your DNA comes from each of your parents however you will share 99.x% of DNA with your parents and other humans.

the 96% DNA sharing with chimpanzees is the variation within the DNA.

if you only shared 50% variation of DNA from your mother, you would probably be a potato.

 

[Loudmouth]

For example, we are told:

"We share 1/2 of our genetic material with our mother
and 1/2 with our father. We also share 1/2 of our DNA,
on average, with our brothers and sisters. Identical twins
are an exception to this rule. They share their entire DNA between them."
​

And would be immediately expressed in percentage terms as:

"We share 50% of our genetic material with our mother
and 50% with our father. We also share 50% of our DNA,
on average, with our brothers and sisters. Identical twins
are an exception to this rule. They share their entire DNA between them."
​

There is no special lingo needed, no misdirection intended,
no confusion of meaning possible, and the geneticist has no need
of special qualifiers, or technical jargon, to describe the situation.

We receive half of our DNA from each parent, but parents share over 99% sequence identity between each other to begin with. It would seem that you are the one using misdirection, not geneticists.

All of your posts are littered with similar misdirection <Staff Edit>.

 

[Nazaroo]

youve totally misunderstood the science.

50% of your DNA comes from each of your parents however you will share 99.x% of DNA with your parents and other humans.

the 96% DNA sharing with chimpanzees is the variation within the DNA.

if you only shared 50% variation of DNA from your mother, you would probably be a potato.