Similarity of human and chimp DNA is down.

[Zaius137]

As genetics improves the number keeps dropping. According to a Wiki article the number could be as low as 70% now.

en.wikipedia.org/wiki/Human_evolutionary_genetics#Genetic_differences_between_humans_and_Neanderthals

And no it is intellectually dishonest to chop up the chimp DNA to align it to human DNA codons to improve the similarity as suggested in this article..

 

[Incariol]

As genetics improves the number keeps dropping. According to a Wiki article the number could be as low as 70% now.

en.wikipedia.org/wiki/Human_evolutionary_genetics#Genetic_differences_between_humans_and_Neanderthals

And no it is intellectually dishonest to chop up the chimp DNA to align it to human DNA codons to improve the similarity as suggested in this article..

...Ok, what is your method for comparative genetics.

 

[USincognito]

This is the formal debate section. I suggest you report your own OP and request the mods move it to the main Creation and Evolution section.

That said, this was posted recently in the Origins Theology section by a geneticist who posts here.

"Unfortunately, it seems to have been written by someone who knows nothing about sequence comparison, or indeed genetics, and is pretty much entirely wrong. First, the 2400 million bases that were compared between the two species weren't the parts of the genome that were similar enough to be aligned; they were the parts that were well enough sequenced in both species to be examined. (Large parts even of the human genome have never been adequately sequenced, because they are too repetitive and therefore too difficult.) After all, if we were only looking at sequence that was highly similar, how would we have identified the indels, which are pieces of sequence in one genome but not in the other?

Second, the 2.7% that is ascribed to copy number variation of large segments is a subset of the differences due to indels (found to total 3% in the chimp genome paper). The paper that Wikipedia cites for the 2.7% is a more detailed look at that class of variation, and was published as a companion paper to the main genome paper.

So the conclusion of the Wikipedia article is completely wrong. How large the differences are between the two genomes depends on exactly how and what you're measuring (as has been said here many times), but the "method" used here is simply insane."

 

[Zaius137]

To be honest with the drawbacks to comparing the two sets of DNA is a good thing to consider. Evolutionists at the time of pronouncing that the human DNA and Chimp DNA were 99% similar strikes me as being intellectually dishonest. In researching the matter new evidence such as gene switches (The field of Epigenetics) have been identified and reclassified from being Pseudogenes. These Pseudogenes were simply cast out from the comparison because they were thought to be “junk” DNA. Also apparently order in the genes is important, indels scattered about a genome can not just be thrust back to a convenient order to improve the comparison. By the way both these are recent findings and go against the grain of what evolutionists have believed. You see as the field of genetics advances (articles in the field are exploding) evolution is still trying to hang onto what they have assumed all along; that chimps and humans are relatives.

The Wiki is no friend to the Christian point of view. I obtained the article from Wiki because I wanted no implied predigest to the creation point of view. It indeed says that chimps and humans might only be 70% the same. If you do not believe that the article is correct (OK).

 

[chris4243]

There's many different ways to talk about similarity -- coding DNA, a specific gene, non-coding DNA, mtDNA, whether you're comparing two individuals or two species, families, or other category, whether silent mutations are counted as differences or not, what to do about inversions, additions, and deletions, if two sequences don't match at all do we still count the 25% coincidental match, etc. By some of the measures we're fairly similar to bananas. What exactly is the supposed 70% similarity referring to?

Oh, and then there's the fact that some differences even if tiny would have a tremendous effect, much like adding "no" somewhere in a sentence, while other differences are irrelevant functionally.

 

[Zaius137]

What was discussed in the article is called “Sequence divergence”.

The section that the citation was drawn from was titled “Sequence divergence between humans and apes” the first paragraph reads:

“The draft sequence of the common chimpanzee genome published in the summer 2005 showed the regions that are similar enough to be aligned with one another account for 2400 million of the human genome’s 3164.7 million bases[21]</SPAN>– that is, 75.8% of the genome. This 75.8% of the human genome is 1.23% different from the chimpanzee genome insingle-nucleotide polymorphisms[21](SNPs - changes of single DNA “letters” in the genome). Another type of difference, calledindels(insertions/deletions) account for another ~3 % difference between the align able sequences.[21]In addition, variation in copy number of large segments (> 20 kb) of similar DNA sequence provides a further 2.7% difference between the two species.[22]Hence the total similarity of the genomes could be as low as about 70%.”</SPAN>

en.wikipedia.org/wiki/Human_evolutionary_genetics

To my understanding “Sequence divergence” means “non-align able sequence”…

Buried in the comparison methods that showed amazing similarities between chimp and human DNA seems to be a common tendency to disregard the non align able sequences. The evolutionist just assumes man and chimp have a common ancestor so disregarding non-align able sequences is a matter of procedure. I believe this difference is over trivialized.

The hydroxyapatite method was a very wide sweep method where non-align able sequences are more of a nuisance than difference. Quote…


“Many years ago, the hydroxyapatite method for measuring
sequence divergence between species was developed by Dave
Kohne and me. In this method, hybrid DNA strand pairs were
formed from small fragments and the temperature at which they
were disassociated determined. This method was used by several
groups to compare chimpanzee and human DNA (1–3), and the
best measurements suggested a divergence of 1.76% of single-copy
DNA preparations. This observation led to the widespread quotations
that we were 98.5% similar to chimps in our DNA, sometimes,
mistakenly, that we had 98.5% gene similarity.”

When indel’s are incorporated in the count then the sequences must again be aligned. Quote…

“Therefore, a FORTRAN program was written to ascertain the actual gaps in alignment. For this purpose, the matching human sequence is
trimmed at the beginning to start exactly in alignment with the
chimp sequence. The program moves sequentially along the pair
of sequences. When it detects a mismatch, if the next 20-nt match
is in more than 15 positions, it is counted as a substitution. If the
next 20 nt do not match this well, then the program looks for a
nearby region that does match and tests for gaps up to 5 kb long
in either sequence to see whether a 20-nt-long test region
matches more than 15 nt.”

Contributed by Roy J. Britten, August 22, 2002

pnas.org/content/99/21/13633.full.pdf

If position in the genome matters in coding then this procedure is already fatally flawed in determining similarity between chimps and man. I will go with 70% simularity.

 

[plindboe]

And no it is intellectually dishonest to chop up the chimp DNA to align it to human DNA codons to improve the similarity as suggested in this article..

So let's say we have this sequence:

ACGTACGTACGTACGTACGTACGTACGTACGT

There's a mutation:

ATCGTACGTACGTACGTACGTACGTACGTACGT

So let's line the two sequences up:

ACGTACGTACGTACGTACGTACGTACGTACGT
ATCGTACGTACGTACGTACGTACGTACGTACGT

So will you say that the two sequences only have the first base in common (~3% similarity)? Or is it fair to chop them up and align them like this (~97% similarity)?:

A-CGTACGTACGTACGTACGTACGTACGTACGT
ATCGTACGTACGTACGTACGTACGTACGTACGT

Peter

 

[Zaius137]

I noticed you added a base and not replaced a base. By length this sequence can no longer be aligned in a meaningful way by comparing base for base. Correlations in sequences are usually taken from their insertion point or (codon point) and compared base pair per base pair. Interestingly enough in your example there is an important correction mechanism in the cell’s self repair mechanism (it is length sensitive); this inserted base is easily removed.

Just for the sake of argument you added enough sequences to bump the coding insertion point. Do you discard the inserted sequence because it is does align? Or does it become part of the difference data?


You might take note that long stretches of meaningful bps have never been inserted by chance (that is fact). Therefore you can not attribute such insertion to a pure evolutionary process (that of mutation and natural selection) and cannot say that the organisms under comparison changed by a pure evolutionary process. Evolution cannot grok the hybridization process or adaptation threw mutation by saying that it is just gene drift. “Each after its own kind”

If base pairs were added by chance (not likly) to change the length then it is likely to negate the meaningful sequence that it dropped into (it would change the insertion point or codon point).

Position does change meaning and must be counted as difference… here is example:

“The mystery arose when scientists counted the number of three-letter codons in the DNA of the virus, fX174. They found that the proteins produced by the virus required many more code words than the DNA in the chromosome contains. How could this be? Careful research revealed the amazing answer. A portion of a chain of code letters in the gene, say -A-C-T-G-T-C-C-A-G-, could contain three three-letter genetic words as follows: -A-C-T*G-T-C*C-A-G-. But if the reading frame is shifted to the right one or two letters, two other genetic words are found in the middle of this portion, as follows: -A*C-T-G*T-C-C*A-G- and -A-C*T-G-T*C-C-A*G-. And this is just what the virus does. A string of 390 code letters in its DNA is read in two different reading frames to get two different proteins from the same portion of DNA. Could this have happened by chance? Try to compose an English sentence of 390 letters from which you can get another good sentence by shifting the framing of the words one letter to the right. It simply can't be done. The probability of getting sense is effectively zero.”

“Sorry I can not yet put in mention” Try to Google the Virus name.

I would say 70% is an optimistic appraisal.

 

[Greg1234]

I noticed you added a base and not replaced a base. By length this sequence can no longer be aligned in a meaningful way by comparing base for base. Correlations in sequences are usually taken from their insertion point or (codon point) and compared base pair per base pair. Interestingly enough in your example there is an important correction mechanism in the cell’s self repair mechanism (it is length sensitive); this inserted base is easily removed.

Just for the sake of argument you added enough sequences to bump the coding insertion point. Do you discard the inserted sequence because it is does align? Or does it become part of the difference data?


You might take note that long stretches of meaningful bps have never been inserted by chance (that is fact). Therefore you can not attribute such insertion to a pure evolutionary process (that of mutation and natural selection) and cannot say that the organisms under comparison changed by a pure evolutionary process. Evolution cannot grok the hybridization process or adaptation threw mutation by saying that it is just gene drift. “Each after its own kind”

If base pairs were added by chance (not likly) to change the length then it is likely to negate the meaningful sequence that it dropped into (it would change the insertion point or codon point).

Position does change meaning and must be counted as difference… here is example:

“The mystery arose when scientists counted the number of three-letter codons in the DNA of the virus, fX174. They found that the proteins produced by the virus required many more code words than the DNA in the chromosome contains. How could this be? Careful research revealed the amazing answer. A portion of a chain of code letters in the gene, say -A-C-T-G-T-C-C-A-G-, could contain three three-letter genetic words as follows: -A-C-T*G-T-C*C-A-G-. But if the reading frame is shifted to the right one or two letters, two other genetic words are found in the middle of this portion, as follows: -A*C-T-G*T-C-C*A-G- and -A-C*T-G-T*C-C-A*G-. And this is just what the virus does. A string of 390 code letters in its DNA is read in two different reading frames to get two different proteins from the same portion of DNA. Could this have happened by chance? Try to compose an English sentence of 390 letters from which you can get another good sentence by shifting the framing of the words one letter to the right. It simply can't be done. The probability of getting sense is effectively zero.”

“Sorry I can not yet put in mention” Try to Google the Virus name.

I would say 70% is an optimistic appraisal.

You can try it here Random Mutation Generator

Intelligence behind adaptation

01/07/30 - ICBP 2000

Darwin's God: Flax: More Falsifications of Evolution and the Real Warfare Thesis

80 yr experiment on random mutation FRUIT FLIES SPEAK UP

 

[chris4243]

I noticed you added a base and not replaced a base. By length this sequence can no longer be aligned in a meaningful way by comparing base for base.

That goes a long way to explaining how you got only 70%.

You might take note that long stretches of meaningful bps have never been inserted by chance (that is fact).

I hope you kept your receipt for that fact, so you can return it for a refund -- you got a defective one. Both transposons and retroviruses can insert large meaningful chunks of DNA.

If base pairs were added by chance (not likly) to change the length then it is likely to negate the meaningful sequence that it dropped into (it would change the insertion point or codon point).

Yes it would. Frame-shift mutations will generally mess up the protein everywhere after the insertion point, almost certainly making the protein useless, and potentially a lot shorter or longer besides.

Position does change meaning and must be counted as difference… here is example:

“The mystery arose when scientists counted the number of three-letter codons in the DNA of the virus, fX174. They found that the proteins produced by the virus required many more code words than the DNA in the chromosome contains. How could this be? Careful research revealed the amazing answer. A portion of a chain of code letters in the gene, say -A-C-T-G-T-C-C-A-G-, could contain three three-letter genetic words as follows: -A-C-T*G-T-C*C-A-G-. But if the reading frame is shifted to the right one or two letters, two other genetic words are found in the middle of this portion, as follows: -A*C-T-G*T-C-C*A-G- and -A-C*T-G-T*C-C-A*G-. And this is just what the virus does. A string of 390 code letters in its DNA is read in two different reading frames to get two different proteins from the same portion of DNA. Could this have happened by chance? Try to compose an English sentence of 390 letters from which you can get another good sentence by shifting the framing of the words one letter to the right. It simply can't be done. The probability of getting sense is effectively zero.”

Good thing it's much easier to make a protein by chance than a meaningful English sentence or human-designed technology. I bet you could change any one of over half the base pairs in that virus, without significantly affecting the protein's function.

 

[Blayz]

It just doesn't matter what method you use (so long as it is credible) or number you assign to human chimp similarity, all that matters is that it is a bigger number than you get when comparing humans to anything else using the same method. There is no magic number below which humans and chimps suddenly stop being related, be it 99%, 90%, 70% or even 0.00003%.

Take a method, compare humans to chimps and then humans to everything else. If the human-chimp number is higher, then they are our recent common ancestor.

 

[prophecyistrue]

It just doesn't matter what method you use (so long as it is credible) or number you assign to human chimp similarity, all that matters is that it is a bigger number than you get when comparing humans to anything else using the same method. There is no magic number below which humans and chimps suddenly stop being related, be it 99%, 90%, 70% or even 0.00003%.

Take a method, compare humans to chimps and then humans to everything else. If the human-chimp number is higher, then they are our recent common ancestor.

Maybe yours not mine!

 

[Zaius137]

I hope you are not in the habit of taking statements out of context…

The entire sentence says:
“You might take note that long stretches of meaningful bps have never been inserted by chance (that is fact).”

And I can support that statement.

Do you believe in evolution? As a Christian it is my opinion we do not need to. The evidence does not support evolution.

 

[chris4243]

I hope you are not in the habit of taking statements out of context…

The entire sentence says:
“You might take note that long stretches of meaningful bps have never been inserted by chance (that is fact).”

And I can support that statement.

You're hilarious. Are you trying to say, "long stretches of meaningful bps have never been inserted by chance, except when they are"? is getting sick not a chance event, are mutations not chance events, or what? Copy errors involving transposable elements don't count?

Do you believe in evolution? As a Christian it is my opinion we do not need to. The evidence does not support evolution.

As a Christian I believe it is my duty to tell the truth.

 

[Zaius137]

About this statement…
“I hope you kept your receipt for that fact, so you can return it for a refund -- you got a defective one. Both transposons and retroviruses can insert large meaningful chunks of DNA.”

I would like to say that transposons and retroviruses are not considered random code but are agents of life, “presupposed Teleonomy”. It is life on life, defiantly not from any random process. My point was poorly made because of the brevity of my statement. I am directly saying that random mutation is antithesis to life without life’s built in capacity to use it. Random processes do not convey information with any sense of meaning. Life makes meaning from random events not the other way round.

Further I know of only one instance of a retrovirus insertion coding in humans and that is a maybe the human placenta (maybe). Do you have an example?



“Good thing it's much easier to make a protein by chance than a meaningful English sentence or human-designed technology. I bet you could change any one of over half the base pairs in that virus, without significantly affecting the protein's function.”

You can’t be serious about “much easier to make a protein by chance” Sorry it would be racemic… not usable by life.

 

[Zaius137]

To Prophecyistrue...

I really subscribe to your conclusion.

By that line of reasoning, what ever human DNA is closest to is what our ancestors were and are relatives are&#8230; that would be other humans.

 

[chris4243]

About this statement…
“I hope you kept your receipt for that fact, so you can return it for a refund -- you got a defective one. Both transposons and retroviruses can insert large meaningful chunks of DNA.”

I would like to say that transposons and retroviruses are not considered random code but are agents of life, “presupposed Teleonomy”. It is life on life, defiantly not from any random process. My point was poorly made because of the brevity of my statement. I am directly saying that random mutation is antithesis to life without life’s built in capacity to use it. Random processes do not convey information with any sense of meaning. Life makes meaning from random events not the other way round.

By that argument, there are no random mutations either because without the DNA made by life, there's nothing to mutate. How about this then: large segments of DNA are on occasion inserted into an organism's genome without human interference. Is that false?

Further I know of only one instance of a retrovirus insertion coding in humans and that is a maybe the human placenta (maybe). Do you have an example?

Retrovirus fragments make up about 10% of our genome, if I remember correctly. And the fragments and mutations to them match those in primates. And just for fun, some scientist reconstructed some of the ancient viruses.

“Good thing it's much easier to make a protein by chance than a meaningful English sentence or human-designed technology. I bet you could change any one of over half the base pairs in that virus, without significantly affecting the protein's function.”

You can’t be serious about “much easier to make a protein by chance” Sorry it would be racemic… not usable by life.

Easily provable... randomly change a few letters in the DNA coding for a protein, and randomly change some of the letters (or the bits if you prefer) in the sentence you just typed. Guess which one will most likely be broken?

 

[Exiledoomsayer]

Maybe yours not mine!

I guess you arent human then. Perhaps a dog that learned to type? I've seen cats play the piano

 

[Zaius137]

I recognize I have sentence structure problems&#8230;

To &#8220;chris4243&#8221;

&#8220;By that argument, there are no random mutations either because without the DNA made by life, there's nothing to mutate. How about this then: large segments of DNA are on occasion inserted into an organism's genome without human interference. Is that false?&#8221;
OK, first about large segments of DNA. Any sizable segment of information such as gene segments in the DNA cannot come together spontaneously in any meaningful way. This argument hinges on information theory and probability bound. Mathematics knows a great deal about probability and probability is practical in describing an outcome of events (random and systematic). Why information theory can be applied to DNA is because DNA is recognized as being an information storage device (ever since James D. Watson and Francis Crick first examined it). Insertions, deletions, transposons (type I and type II), ERV all are know to take place regularly. All of these events follow rules in the DNA mechanism. But meaningful, ordered spontaneous random mutations are not observed (never have been observed).

Further I know of only one instance of a retrovirus insertion coding in humans and that is a maybe the human placenta (maybe). Do you have an example?

&#8220;Retrovirus fragments make up about 10% of our genome, if I remember correctly. And the fragments and mutations to them match those in primates. And just for fun, some scientist reconstructed some of the ancient viruses.&#8221;

Do they &#8220;code&#8221;? If so where are they active? Or are they just supposed remnants of a past infection?

&#8220;Good thing it's much easier to make a protein by chance than a meaningful English sentence or human-designed technology. I bet you could change any one of over half the base pairs in that virus, without significantly affecting the protein's function.&#8221;

You can&#8217;t be serious about &#8220;much easier to make a protein by chance&#8221; Sorry it would be racemic&#8230; not usable by life.

Easily provable... randomly change a few letters in the DNA coding for a protein, and randomly change some of the letters (or the bits if you prefer) in the sentence you just typed. Guess which one will most likely be broken?

OK try this from &#8220;Greg1234&#8221; (Thanks I can use this)
randommutation.com/

My assumption is: DNA coding (information)>>human sentence (information)
__________________

 

[plindboe]

I noticed you added a base and not replaced a base.

Yes, it's a mutation known as an insertion. Read about the various types of mutations here, or if you want to read studies detailing this phenonemon there are countless. Insertions and deletions are common types of mutations and because of them, when you want to compare sequences you can't simply put one over the other and then count the differences. This is one of the reasons why we have to insert gaps, or "chop up" the sequences as you initially phrased it.

Interestingly enough in your example there is an important correction mechanism in the cell&#8217;s self repair mechanism (it is length sensitive); this inserted base is easily removed.

Yes, there are repair mechanisms, but the thing is that they aren't flawless, and once in a while a mutation gets through; insertions and deletions included. You have about 120 mutations unique to you that weren't present in your parents' genomes. Most of these are neutral of course, but they are still present in the genome.

Just for the sake of argument you added enough sequences to bump the coding insertion point. Do you discard the inserted sequence because it is does align? Or does it become part of the difference data?

As you can see in the numbers in my former post, I've counted the insertion as the sequences are obviously different after the mutation (97%). But of course the counting method will depend on what a study is set out to measure. These numbers are often oversimplified in the popular press, so it's often best to read the study in question to find out what exactly was measured.

You might take note that long stretches of meaningful bps have never been inserted by chance (that is fact).

Are you omniscient? If not, try not to make statements that require omniscience. In any case, your statement is wrong. The field of genetic engineering is build around the fact that DNA can be more or less randomly absorbed from the environment, naked DNA strands, or via viruses or organisms and be more or less randomly inserted in the genomes of various life forms. There are other ways for long stretches of DNA to be inserted into genomes; retroviruses and transposons have been mentioned, and unequal crossovers during recombination can result in duplications of long sequences.

I would say 70% is an optimistic appraisal.

But you don't know why the researchers chose to "only" align 75.8% of the genomes. As pointed out earlier there can be reasons why the other 24.2% weren't aligned. Likely it's partly because of the huge work involved (6 billion bases are alot to sit and align manually), so they focused on the areas that were most easily aligned via software, for instance by leaving out highly repetitive sequences. Also, as mentioned earlier, the study had to omit alot of sequences because they hadn't been adequately sequenced to be of use. That you're assuming that the 24.2% not included in the analysis has nothing in common between the two species is a huge leap of faith on your part. You have to actually read the study and try to understand why they did as they did, what they did and what they found, instead of simply quote-mining a snippet you found on wikipedia. This is the paper linked by wiki. Read it.

Lesson for today: Just because you read something on the internet that you like to read, doesn't make it a fact.

Peter