1. Welcome to Christian Forums, a friendly forum to discuss Christianity in a friendly surrounding.

    Your voice is missing! You will need to register to get access to the following site features:
    • Reply to discussions and create your own threads.
    • Our modern chat room. No add-ons or extensions required, just login and start chatting!
    • Access to private conversations with other members.

    We hope to see you as a part of our community soon!

Misdirection in Claim of 97% DNA match in Humans, Chimps

Discussion in 'Creation & Evolution' started by Nazaroo, Jan 3, 2013.

Thread Status:
Not open for further replies.
  1. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
    I would add this 'error', or rather deliberate fraud to the long list of Evolutionist self-delusions, but it deserves its own thread as stunning example
    of how propaganda is manufactured for deliberate effect.

    The normal use of percentages to express similarity,
    even estimates and guesstimates,
    does not involve extra layers of sophisticated
    misdirection or fakery.

    If a man says 'these two objects are 50% the same,
    the meaning is transparently clear.
    Half the features, components, arrangement, and/or surface
    will be essentially identical.

    In fact IQ tests abound with such tests,
    which require the reader to make the correct interpretation
    of a phrase and usage of the percentage sign.

    Looking at the picture below, the viewer has no problem
    identifying the two meals as 100% identical, except for the plate:

    [​IMG]

    The field of Genetics is no exception to normal English usage,
    or at least it shouldn't be, and most of the time it hasn't been,
    ...until recently.


    For example, we are told:
    "We share 1/2 of our genetic material with our mother
    and 1/2 with our father. We also share 1/2 of our DNA,
    on average, with our brothers and sisters. Identical twins
    are an exception to this rule. They share their entire DNA between them."

    And would be immediately expressed in percentage terms as:
    "We share 50% of our genetic material with our mother
    and 50% with our father. We also share 50% of our DNA,
    on average, with our brothers and sisters. Identical twins
    are an exception to this rule. They share their entire DNA between them."

    There is no special lingo needed, no misdirection intended,
    no confusion of meaning possible, and the geneticist has no need
    of special qualifiers, or technical jargon, to describe the situation.

    But having viewed the above statement, which in light of genetic laws
    of inheritance is not just clear but obvious and accurate,
    the reader will immediately become aware of a huge problem
    in the use of the very same language and expression in the claim below:


    [​IMG]


    Who can help but notice that if the claim about parents and siblings is true,
    the statement about chimpanzees must be on the face of it FALSE.


    How can anyone share more DNA with a monkey than with their own parents?

    Of course the answer is in the fact that the Evolutionists have deliberately
    misled us by moving the goalposts once again.


    It will be no mystery to discover the Evolutionists
    have taken very sophisticated and heavily qualified statements
    by geneticists, and twisted them around, creating total BS.
     
  2. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
    "a brother might share 52% of his DNA with one sibling and 47% with another sibling." (wiki ISOGG)

    These percentages are naturally absolute terms, and entirely reversible in expression,
    the differences and matches adding up to a total of 100%:

    " For example, your first cousin has 12.5% of the genes you do (implying, inversely, that 87.5% of their genes are different)."
    (Kennon)

    In the light of this obvious fraud,
    it will hardly be a surprise to find
    that the Evolutionist apologists
    can't even keep their own numbers straight:

    Thus we have:

    "Humans share over 90% of their DNA with their primate cousins. "
    (Science Daily)

    Chimpanzee 98% shared DNA with humans. (NAS Science Museum)

    "Humans, for example, share 99.6% of their DNA with chimpanzees." (Life Science)

    "Chimps, Humans 96% the same:
    A comparison of Clint's genetic blueprints with that of the human genome shows that our closest living relatives share 96 percent of our DNA." (Nat. Geographic News)

    And let us not think that these propagandists do not mean to mislead us:
    What can they possibly intend the reader to understand, when they
    say things like this:

    "If genetic code is a book, what we found is that entire pages of the book duplicated in one species but not the other," said Eichler. (Nat. Geographic News)
    But wait... Evolutionists themselves have supposedly tried to correct the excesses,
    back as early as 2003:

    "A new report in the Proceedings of the National Academy of Sciences suggests that the common value of >98% similarity of DNA between chimp and humans is incorrect.1 Roy Britten, author of the study, puts the figure at about 95% when insertions and deletions are included. Importantly, there is much more to these studies than people realize." (AnswersInGenesis)
    Did we get that right? ..insertions? ...deletions? what do they mean?

    Quote:
    The >98.5% similarity has been misleading because it depends on what is being compared.

    Say what?

    No Kidding Sherlock.

    You mean they haven't been exactly straight with us on what they are measuring?


    Quote:
    There are a number of significant differences that are difficult to quantify. A review by Gagneux and Varki2 described a list of genetic differences between humans and the great apes. The differences include ‘cytogenetic differences, differences in the type and number of repetitive genomic DNA and transposable elements, abundance and distribution of endogenous retroviruses, the presence and extent of allelic polymorphisms, specific gene inactivation events, gene sequence differences, gene duplications, single nucleotide polymorphisms, gene expression differences, and messenger RNA splicing variations.’2
    Specific examples of these differences include:

    1. Humans have 23 pairs of chromosomes while chimpanzees have 24. Evolutionary scientists believe that one of the human chromosomes has been formed through the fusion of two small chromosomes in the chimp instead of an intrinsic difference resulting from a separate creation.
    2. At the end of each chromosome is a string of repeating DNA sequences called a telomere. Chimpanzees and other apes have about 23 kilobases (a kilobase is 1,000 base pairs of DNA) of repeats. Humans are unique among primates with much shorter telomeres only 10 kilobases long.3
    3. While 18 pairs of chromosomes are ‘virtually identical’, chromosomes 4, 9 and 12 show evidence of being ‘remodeled.’4 In other words, the genes and markers on these chromosomes are not in the same order in the human and chimpanzee. Instead of ‘being remodeled’ as the evolutionists suggest, these could, logically, also be intrinsic differences because of a separate creation.
    4. The Y chromosome in particular is of a different size and has many markers that do not line up between the human and chimpanzee.5
    5. Scientists have prepared a human-chimpanzee comparative clone map of chromosome 21 in particular. They observed ‘large, non-random regions of difference between the two genomes.’ They found a number of regions that ‘might correspond to insertions that are specific to the human lineage.’6
    These types of differences are not generally included in calculations of percent DNA similarity.


    Wait, they left out many significant and already well-known differences,

    when "calculating" the differences?


    WTHeck?



    Quote:
    In one of the most extensive studies comparing human and chimp DNA,6 the researchers compared >19.8 million bases.
    While this sounds like a lot, it still represents slightly less than 1% of the genome.

    Wait wait wait...


    They only actually compared less than 1% of the DNA?


    Quote:

    They calculated a mean identity of 98.77% or 1.23% differences. However, this, like other studies only considered substitutions and did not take insertions or deletions into account as the new study by Britten did. A nucleotide substitution is a mutation where one base (A, G, C, or T) is replaced with another. An insertion or deletion (indel) is found where there are nucleotides missing when two sequences are compared.
    [​IMG]
    Figure 1. Comparison between a base substitution and an insertion/deletion. Two DNA sequences can be compared. If there is a difference in the nucleotides (an A instead of a G) this is a substitution. In contrast, if there is a nucleotide base which is missing it is considered an insertion/deletion. It is assumed that a nucleotide has been inserted into one of the sequences or one has been deleted from the other. It is often too difficult to determine whether the difference is a result of an insertion or a deletion and thus it is called an ‘indel’. Indels can be of virtually any length.

    The Britten1 study looked at 779 kilobase pairs to carefully examine differences between chimpanzees and humans. He found that 1.4% of the bases had been substituted, which was in agreement with previous studies (98.6% similarity). However, he found a much larger number of indels. Most of these were only 1 to 4 nucleotides in length, although there were a few that were > 1000 base pairs long. Surprisingly, the indels added an additional 3.4 % of base pairs that were different.
    While previous studies have focused on base substitutions, they have missed perhaps the greatest contribution to the genetic differences between chimps and humans. Missing nucleotides from one or the other appear to account for more than twice the number of substituted nucleotides. Although the number of substitutions is about ten times higher than the number of indels, the number of nucleotides involved in indels is greater. These indels were reported to be equally represented in the chimp and human sequences. Therefore, the insertions or deletions were not occurring only in the chimp or only in the human and could also be interpreted as intrinsic differences.
    Will evolution be called into question now that the similarity of chimpanzee and human DNA has been reduced from >98.5% to ~95%? Probably not. Regardless of whether the similarity was reduced even below 90%, evolutionists would still believe that humans and apes shared a common ancestor.

    Can you say 'scientism fraud'?
     
  3. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
    What we learn when we dig deeper into the sloppy use of language
    by Evolutionist propagandists, is that they are using the expressions,
    "DNA" and "Genes" interchangeably, even though they know these
    items are NOT interchangeable.

    When an Evolutionist says "96% of DNA is shared",
    what they really mean is that "96% of GENES appear to be shared.".

    The causal reader may at first glance say,
    "I don't get it: Whats the difference there?
    I'm not following you here..."

    The answer is actually rather simple.
    Currently biologists make a distinction between several different types of DNA,
    segments which are defined by their presumed 'function' (or non-function):
    Thus we have:
    (1) Genes: segments of DNA that are known to do something, like code proteins.
    (2) Regulating DNA: coded DNA that regulates Genes and other segments, turning them on and off, and coordinating their actions.
    (3) Uncoded DNA segments: whose function is unknown, and often presumed non-functional.
    (4) Repetative DNA: DNA which seems to be just repeating patterns, possibly only encoding the beginning or ending of a sequence, like book-ends.
    (5) "Junk-DNA": segments of DNA which are almost certainly either meaningless or broken, such as portions that formerly allowed a creature to make Vitamin C, or segments of crap inserted by a virus.
    When comparing Humans and Chimps in the past, scientists concentrated on already identified Genes,
    segments of DNA which were known to encode proteins and similar molecules.
    Protein-Encoding DNA however,
    only includes about 1% of our DNA:


    [​IMG]

    In fact, the Human Genome can be broken down according to current knowledge,
    by category as follows:

    [​IMG]

    In the above pie-chart, the large light-blue-green section
    represents NON-coding DNA, as far as is known.


    Another more detailed breakdown of percentages is as follows:


    [​IMG]

    [​IMG]


    Several types of DNA segments have already been identified
    as no longer being 'junk'-DNA or 'uncoded-DNA', but are now
    known to be regulating-DNA which functions to oversee layout
    and specialization of cells in an individual.

    We don't need to delve into the controversy of "Junk-DNA"
    to understand that we are only gradually understanding the
    purpose(s) of various segments of DNA in the Human Genome.

    Although DNA previously thought to be "Junk" has been found to have
    interesting regulatory functions, the total amount of DNA classed as
    "Uncoded-DNA" is still very substantial, and we are not likely to
    be able to map the functions of the bulk of "Uncoded-DNA" very soon.
    Because of this, a better name than "uncoded-DNA" might be
    "Not Yet Understood- DNA".

    In discussing the sharing of DNA between Man and Chimp,
    Identifiable Genes were what was focused on,
    and it was assumed that most of the DNA in the Genome was
    'uncoded DNA', that is, DNA without a function, and which
    had presumably accumulated like a junk-yard through the process of evolution.

    It is known that viruses can insert malicious or 'junk-DNA' into chromosomes,
    and much of the differences found between species in the 'uncoded-DNA' region
    was assumed to have been caused by either random mutation (transposition, insertion),
    or by viral infection.

    Because biologists already had a presupposed theory for differences in the
    'uncoded-DNA' region, those differences could be safely ignored when
    comparing Human and Chimp DNA.

     
  4. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
    [​IMG]


    Getting back to the typical charts used to sell Man's descent from early apes (hominids),


    We must now note the glaring problem in interpreting the percentages shoved in our face.

    If Man shares 25%-50% of his DNA with fruitflies and yeast,

    then about that amount must be ignored when discussing the question
    of Man's relation to early Apes.

    98% now becomes something more along the lines of 35-48%

    of DNA code which might be claimed as significant to the question of Common Descent from early Apes.

    This 35-48% must be further trimmed by another 10% for generalized

    mammalian code and perhaps another 20% for regulatory coding that
    will be common to all species of animal and even plant.

    We are looking at a residual 10-15% of DNA
    coding that might be

    useable as some kind of evidence of common descent.

    As the latest investigations conclude, even this much genetic overlap

    may be of little significance at all, because the bulk of physical features
    that define speciation are not controlled by normal Genes, but rather
    by the 'regulatory-DNA' which has been unappreciated hitherto:
    That is, genetic biologists have discovered that speciation is
    primarily caused by the areas of DNA previously ignored.

    The actual differences between Man and Chimps in respect of
    gross, raw or bulk DNA is of little significance to speciation,
    and therefore of little significance for Common Descent.

    What matters is the OTHER, regulatory codes controlling morphology,
    and these are significantly NOT LIMITED to raw DNA sequences,
    but are also encoded in the ARRANGEMENTS of code segments.

    This is an astounding and exciting finding,
    which goes entirely against the parading of
    fudged percentages of similarity for raw DNA content.



    Look again at the following chart (in particular, section B):

    [​IMG]



    Over 20% of Human DNA is now known to be made up of Regulatory Sequences,
    which are now acknowledged to control physical layout, features, proportions, and general speciation.
    These were formerly thought to be 'junk DNA' or 'uncoded DNA'.

    If a significant portion of this 20% is now known to be the main source of
    the differentiation between Man and Chimps,
    then the claim that Man and Chimp share 98% of DNA is total nonsense.
     
  5. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
    Curious Windowshopper: Are these real gold coins?

    Evolutionist Jeweller: Sure. They are 99.9% gold.

    Curious Windowshopper: Really? how many did you test?

    Evolutionist Jeweller: Just one. Thats all you need, to know they are real.

    Curious Windowshopper: ... So, which one did you test? I'll buy that one.

    Evolutionist Jeweller: Sorry, I don't know. I put it back with the others.

    Curious Windowshopper: Um... I think I'll come back later.


    [​IMG]

    Get a Clue:


    (1) Professor Plum was murdered in the Kitchen with a Knife.

    (2) Kernel Mustard was murdered in the Livingroom with a Gun.

    ...depending upon which possibilities you want to include or exclude.


    [​IMG]
     
  6. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
    A simple moment of reflection shows that if about 67-70% of regulatory elements (DNA) are identical,
    then about 30-33% of them are different.

    If Regulatory elements comprise about 20% of human DNA,
    then about 13.4% of that is identical,
    leaving about 6.6 % of the Genome in this area DIFFERENT.

    Adding that 6.6% to the 4% of protein encoding genes admitted to be different, we have actually about

    10.6% of Human DNA now known to differ from that of chimps.

    This leaves possibly identical DNA at less than 89%, not the 96% claimed,
    which was based on a 1% sample of protein encoding genes.
     
  7. Subduction Zone

    Subduction Zone Regular Member

    Messages:
    10,681
    Likes Received:
    5
    Faith:
    Atheist
    Too long didn't read.

    Yes, there are different ways to measure the differences. But when we use the method that gives us a difference using shared DNA we see that we are closest to the animals that we had the closest common ancestor with. In other words, shared DNA supports the theory of evolution.

    There is no dishonesty, the only dishonesty I saw was by the OP when he tried comparing sharing chromosomes to sharing DNA.
     
  8. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
    Well, lets see what others have said on the same subject:

    So when we see Evolutionists playing fast and loose with words,
    confusing "similar" and "identical",
    we see he is only copying what other propagandists do,
    in obscuring the two completely different meanings.


    [​IMG]




    Human and Chimp DNA is NOT 96% IDENTICAL,
    and the percentage is NOT based on checking the entire Humane Genome.

    Human and Chimp DNA is an estimated 96% SIMILAR,
    and the percentage is based on checking ABOUT 1% of the Human Genome.
     
  9. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
    When we delve into the details of how guesstimates of a match are made,
    in trying to measure the similarity of DNA, we can get some insight into the
    computational problem by a look at various proposed methodologies:


    To give some idea of the historical development of the methods of comparing DNA across species, the following US Govt. chart and
    explanation is enlightening:

    Quote:
    It is obvious that these crude methods, naive attempts to 'match'
    the literally billions of sequences that make up an animal's DNA,
    are trivially inaccurate and quite open to abuse by propogandists
    on all fronts.
     
  10. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
    So when we are told that:

    "Humans share 92% of their DNA with Mice."
    We can tell by the actual picture of the 'reconstruction'
    that we are simply not being told the whole story.

    [​IMG]

    The actual gymnastics that Evolutionists have had to go to,
    to achieve a "92% match" is astounding, not for its innovation,
    but for its basic dishonesty.


    For several things are being misrepresented here,
    and it is not accidental:


    (1) The alleged 'matches' are not 100% identical matches,
    but began as guesses based on dying chromosomes by color, in an attempt to identify similar segments. Now computer runs look for about a 30% target match before
    jumping to the next DNA segment, to save computing time over the ominously
    large calculation problem.

    (2) The drastic rearrangement of the chromosome material is entirely discounted
    in assessing similarity of content, and also most importantly, similarity of function.

    (3) The use of language continues to be dishonest when dealing with the public.
    When geneticists say something like "96% similar" they are deliberately
    avoiding a more precise language, such as "96% IDENTICAL", because
    they know damn well these portions for which they have formed a 'match'
    ARE NOT IDENTICAL AT ALL, but are categorized as "Similar" on the basis
    of a 30% internal local match in nucleotide sequencing.


    That's right.
    A DNA segment is called a 'match' if it aligns with 30% of its target.

    If we suppose (applying a reasonably sceptical methodology)
    that the remaining 70% of the segment has a (generous) 25% match
    over four nucleotides possible, then as much as 52.5% of the material 'matched' could actually vary in detailed content and pattern.

    That drops the 96% down to a whoppingly low 43.5% match
    between Human and Chimp over the entire Genome.
     
  11. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
    Computer runs are easy things to set up and estimate, providing you have the data in convenient form and some useful search algorithms:

    But as people have already observed, you have to select DNA segment sizes that are going to be meaningful.
     
  12. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
  13. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
    Wonders of Science:


    [​IMG]


    [​IMG]


    [​IMG]
     
  14. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
  15. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
  16. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
  17. Loudmouth

    Loudmouth Contributor

    Messages:
    34,480
    Likes Received:
    164
    Faith:
    Agnostic
    species A: AATATTTATATT--GGAATTT
    species B: AATATTTACATTCTGGAATTT

    According to you, how should the scientific community report the similarity between these two species at the DNA level?
     
  18. cf123

    cf123 Guest

    youve totally misunderstood the science.

    50% of your DNA comes from each of your parents however you will share 99.x% of DNA with your parents and other humans.

    the 96% DNA sharing with chimpanzees is the variation within the DNA.

    if you only shared 50% variation of DNA from your mother, you would probably be a potato.
     
  19. Loudmouth

    Loudmouth Contributor

    Messages:
    34,480
    Likes Received:
    164
    Faith:
    Agnostic
    We receive half of our DNA from each parent, but parents share over 99% sequence identity between each other to begin with. It would seem that you are the one using misdirection, not geneticists.

    All of your posts are littered with similar misdirection <Staff Edit>.
     
    Last edited by a moderator: Jan 16, 2013
  20. Nazaroo

    Nazaroo Joseph is still alive! (Gen 45.26)

    Messages:
    2,545
    Likes Received:
    41
    Faith:
    Christian
    [​IMG]
     
Thread Status:
Not open for further replies.