Creation & EvolutionForum for the discussion of this important topic. This forum is open to non-believers. There is a Christians-only forum in the Christians-only section too.
The single nested hierarchy of species is not a debatable topic. It's been well understood since Carl Linnaeus first discovered it nearly 300 years ago.
Actually, depending on what you mean, it is debatable. If you mean that man came from a shrew.
Perhaps the problem here is that you don't know what a nested hierarchy is. A nested hierarchy is an arrangement of objects (species in this case) such that you get groups(taxa) within groups. A bit like the folders on your hard drive.
All objects can be arranged, depends on who is doing the arranging.
Now, this nested hierarchy of species encompasses all living things.
We can put all living things in groups if we wish, sure. There are a few ways we can do this.
Evolution explains this nested hierarchy as being due to descent with modification. Each taxa defines a set of species that have inherited specific traits (such as a backbone, or an ERV) from an ancestor in which that trait first evolved.
Right, an obsene concept if ever there was one. To me it is like saying, we are octopusses, because we have arms.
If special creation were true, we'd not have a single tree, but multiple, little trees, each one rooted in one of these created kinds.
Oh, Ha. No, because of the fast adapting that could go on in the past! This means that a lot of evolution did go on, so we expect an arrangement like we see.
If special creation were true, there is nothing that prevents a creator from making whales with gills. But that cannot be reconciled with evolution.
What prevents Him having made things like they are???
Modern taxonomy is done using cladistic methods, which are statistical algorithms that produce the most likely phylogenies based on a character matrix for a given set of species.
Most likely assuming they were not created. Trying to cook up the best self made explanation with no creation, assuming evolution from the worm. Pointless stats, to say the least.
The method is robust, and we find that the results of these methods produce trees that are converging on a single, true phylogeny.
No, you don't. Nothing true about it. The creation and the fantastic subsequent evolving, you simply lump together, and run a ridiculous assumption based statistical algorithm, to cook up an imaginary tree with all creatures on it.
There is no reason to expect this to be true if special creation were true. If special creation were true, we'd have to imagine that god created these kinds such that they'd appear to be related. Sounds like a pretty tricky god to me.
No! You simply thought the evolution that did go on was all that went on.
Whatever the case, you have still not proposed an explanation in which a single, nested hierarchy of species is a required consequence.
Read this post, I did that. Creation + hyperevolution = whatwesee.
The single nested hierarchy of species. That birds are tetrapods unites them with humans. That fungi and plants are eukayotes unites them with animals. All species are on the same tree.
'Gee, we have cells, and chromosomes with some structure, we are all a big happy family, the worms, and fungi and us'
That is your whole arguement. You have to go to school for that???!!!
But you see, the nested hierarchy of species DOES have real import. It exists. It is a real thing. A thing that creationists cannot explain, absent a bunch of hand waving.
In this you are almost correct. The most parsimoneous explanation for the presence of orthologous endogenous retroviruses is inheritence. But there is no reason to go special pleading humans out of that equation. When humans and chimpanzees share such a genetic trait, then we must follow the evidence and say that they inherited this genetic feature from a common ancestor.
I already covered that we don't know the past state, and how life processes were, and the retrovirus ancestor got around.
All we can see is that it was passed down. And where's that?
__________________ The present is...NOT...the key to the past. That is where science messed up. The future is the key to the past.
Last edited by dad; 22nd October 2006 at 03:32 PM.
Look at the qualifications they attach to their research:
Based on analysis of finished BAC chimpanzee genome sequence, we characterize a retroviral element (Pan troglodytes endogenous retrovirus 1 [PTERV1]) that has become integrated in the germline of African great ape and Old World monkey species but is absent from humans and Asian ape genomes. We unambiguously map 287 retroviral integration sites and determine that approximately 95.8% of the insertions occur at non-orthologous regions between closely related species. Phylogenetic analysis of the endogenous retrovirus reveals that the gorilla and chimpanzee elements share a monophyletic origin with a subset of the Old World monkey retroviral elements, but that the average sequence divergence exceeds neutral expectation for a strictly nuclear inherited DNA molecule. Within the chimpanzee, there is a significant integration bias against genes, with only 14 of these insertions mapping within intronic regions. Six out of ten of these genes, for which there are expression data, show significant differences in transcript expression between human and chimpanzee. Our data are consistent with a retroviral infection that bombarded the genomes of chimpanzees and gorillas independently and concurrently, 3–4 million years ago. We speculate on the potential impact of such recent events on the evolution of humans and great apes.
They find PTERV1 in African great ape and Old World monkey species but is absent from humans and Asian ape genomes. This should be good.
Note the three independent verifications of horizontal transfer:
1. Non-orthology of insertion locations.
2. PTERV phylogeny inconsistent with primate phylogeny.
3. Significantly higher single-nucleotide substitution rate.
Sounds about right.
Now, if we only had a phylogenetic mismatch, but orthologous insertions and normal mutation rates, I would agree that there was something fishy. As it is, we have confirmation of horizontal transfer that is completely independent of the phylogenetic relationships concerned. So this does not amount to a substantive disproof of ERV phylogeny, as far as I'm concerned it looks like you're grasping at straws since we've already dealt with PtERV in your ERV thread weeks ago.
Frankly, nothing has been dealt with. Lets take another look at this:
1) The germline invasion supposedly happened 25-30 mya before the OWM /NWM split.
2) The (HERVK10) is the last active ERV in the human genome and insertions are rare to begin with.
3) ERVs make up 8% of the human genome, which means hundreds of millions of base pairs are simply remnants or duplications of ancient retroviruses.
4) PtERV is found in African great apes and OWM but is absent in human and Asian great apes.
The homology arguement you are using, and that is what it is, fails to provide consistant proof. I keep trying to track down what you guys are saying but I still don't find these mystery ERVs that you are talking about. Where are they, what are they called, what class of ERV are they?
Better yet, characterize an orthologous ERV insertion and identify it. I'm getting tired of seeing this talked in circles, where are these mystery ERVs you guys want to pontificate about endlessly?
Nothing is going to be dealt with until you identify these ERVs you are making such a fuss about.
__________________
“Gärtner, by the results of these transformation experiments, was led to oppose the opinion of those naturalists who dispute the stability of plant species and believe in a continuous evolution of vegetation. He perceives in the complete transformation of one species into another an indubitable proof that species are fixed with limits beyond which they cannot change.” (G. Mendel)
Mark, please stick to ERV's that are at orthologous positions for dealing with evidence of common ancestry. ERV's that are not found at orthologous positions are irrelevant to the discussion.
__________________ “It took me years, but letting go of religion has been the most profound wake up of my life. I feel I now look at the world not as a child, but as an adult. I see what's bad and it's really bad. But I also see what is beautiful, what is wonderful. And I feel so deeply appreciative that I am alive. How dare the religious use the term 'born again.' That truly describes freethinkers who've thrown off the shackles of religion so much better!” - Julia Sweeney
Mark, please stick to ERV's that are at orthologous positions for dealing with evidence of common ancestry. ERV's that are not found at orthologous positions are irrelevant to the discussion.
No problem all you have to do is tell me of one, the class, location and comparison. I have asked you repeatedly to assign some qualification to what you are saying and you have not done so. If you want to talk about othologous positions then tell me the position of this supposed smoking gun.
By the way, I discovered a few on my own but I refuse to do your research for you. Either support what you are saying with actual facts are keep talking in circles, it makes no difference to me.
__________________
“Gärtner, by the results of these transformation experiments, was led to oppose the opinion of those naturalists who dispute the stability of plant species and believe in a continuous evolution of vegetation. He perceives in the complete transformation of one species into another an indubitable proof that species are fixed with limits beyond which they cannot change.” (G. Mendel)
No problem all you have to do is tell me of one, the class, location and comparison. I have asked you repeatedly to assign some qualification to what you are saying and you have not done so. If you want to talk about othologous positions then tell me the position of this supposed smoking gun.
And I have pointed out to you where you can find them. Lebedev et. al. 2000 lists 11 separate ERV's that are found at orthologous positions in different species, and three more that are only found in humans. As they state in their abstract, they found these ERV's by looking at positions that were known to be orthologous between humans and other primates, and looked for ERV's within those areas of the genome. They found 14 such ERV's in the human samples, and 11 of those were shared between other primate species, all consistent with the phylogenic tree.
How do you account for the fact that the human-only ERV's are by far a minority of the total number of ERV's found? How do you account for the fact that those that are shared are all consistent with the phylogenic tree?
__________________ “It took me years, but letting go of religion has been the most profound wake up of my life. I feel I now look at the world not as a child, but as an adult. I see what's bad and it's really bad. But I also see what is beautiful, what is wonderful. And I feel so deeply appreciative that I am alive. How dare the religious use the term 'born again.' That truly describes freethinkers who've thrown off the shackles of religion so much better!” - Julia Sweeney
And I have pointed out to you where you can find them. Lebedev et. al. 2000 lists 11 separate ERV's that are found at orthologous positions in different species, and three more that are only found in humans. As they state in their abstract, they found these ERV's by looking at positions that were known to be orthologous between humans and other primates, and looked for ERV's within those areas of the genome. They found 14 such ERV's in the human samples, and 11 of those were shared between other primate species, all consistent with the phylogenic tree.
How do you account for the fact that the human-only ERV's are by far a minority of the total number of ERV's found? How do you account for the fact that those that are shared are all consistent with the phylogenic tree?
I account for them by dismissing the claim that all the ERVs are the result of germline invasions. We are talking about 8% of 3 billion base pairs. What do you think the odds are of 11 being the same when we are talking about hundreds of millions of base pairs?
Now go back and find these obscure ERVs and tell me the name, location and comparison.
__________________
“Gärtner, by the results of these transformation experiments, was led to oppose the opinion of those naturalists who dispute the stability of plant species and believe in a continuous evolution of vegetation. He perceives in the complete transformation of one species into another an indubitable proof that species are fixed with limits beyond which they cannot change.” (G. Mendel)
I account for them by dismissing the claim that all the ERVs are the result of germline invasions. We are talking about 8% of 3 billion base pairs. What do you think the odds are of 11 being the same when we are talking about hundreds of millions of base pairs?
The experimental group didn't look all over the genome for the same sequence. They sequenced specific areas of each genome that were known to be orthologous. In some species they got, for example:
ATCATAGCCTTACG
Whereas in other species they got:
ATCATAGGTCACCTAGCCCTTACG
...or something to that effect (though with a few random mutations thrown in for good measure). In some species you get one type of gene. In other species you get the other. These genes are clearly inherited. And the similarities exist only within a pattern consistent with a hierarchical structure.
We don't need to worry about where the similarity came from, just that it can be inherited, and exists in some species but not others. As an argument for common descent, that's all you need. Hierarchical structure of inherited traits = common descent. Unless you can think of another method for generating a hierarchical structure.
__________________ “It took me years, but letting go of religion has been the most profound wake up of my life. I feel I now look at the world not as a child, but as an adult. I see what's bad and it's really bad. But I also see what is beautiful, what is wonderful. And I feel so deeply appreciative that I am alive. How dare the religious use the term 'born again.' That truly describes freethinkers who've thrown off the shackles of religion so much better!” - Julia Sweeney
Actually, depending on what you mean, it is debatable. If you mean that man came from a shrew.
The nested hierarchy of species existed prior to our explaining it. Absent common ancestry it doesn't make sense. But its existence is not in doubt.
Originally Posted by dad
All objects can be arranged, depends on who is doing the arranging.
In this case, it was originally Carl Linnaeus, a devout christian. But that's not really important right now. What is important is that this arrangement of species is not arbitrary. It is actually a natural, nested hierarchy. This means that we do not find species that should be classified in multiple taxa. Try grouping created objects into a nested hierarchy without finding out that something belongs in more than one group.
Originally Posted by dad
We can put all living things in groups if we wish, sure. There are a few ways we can do this.
And none of them make as much sense as the natural, nested hierarchy of taxonomy. That's why it's stuck for nearly 300 years.
Originally Posted by dad
Right, an obsene concept if ever there was one. To me it is like saying, we are octopusses, because we have arms.
Persdonal distate for something is not actually a valid argument against it. And no, taxonomy is nothing like your characterization of it. It is more like saying that eukaryotes are all species that have a cell nucleus and other internal organelles. Or that Deuterstomes are all species that develop an anus before a mouth. Interesting fact, all chordates are deuterstomes. I've yet to have a creationist explain why this must be so.
Originally Posted by dad
Oh, Ha. No, because of the fast adapting that could go on in the past! This means that a lot of evolution did go on, so we expect an arrangement like we see.
How does rapid divergence of created kinds lead to a single nested hierarchy of species?
Originally Posted by dad
What prevents Him having made things like they are???
Nothing. But nothing requires it either. A creator can explain any natural organization of species, from a linnear progression, to an undirected graph, to no organization at all with each species being entirely unique.
Originally Posted by dad
Most likely assuming they were not created. Trying to cook up the best self made explanation with no creation, assuming evolution from the worm. Pointless stats, to say the least.
No, most likely meaning most parsimoneous. That is, it builds a phylogeny that makes the fewest assumptions. These methods will work with any type of object, doesn't even need to be biological. You just won't get very good statistical support for your results.
Originally Posted by dad
No, you don't. Nothing true about it. The creation and the fantastic subsequent evolving, you simply lump together, and run a ridiculous assumption based statistical algorithm, to cook up an imaginary tree with all creatures on it.
No, what we do is run the algorithms on various taxa, using relevent character matrices to test hypotheses about relationships. What we find is that results of such independent tests are consistent. This supports the hypotheses that there is a single, true phylogeny of living things.
Originally Posted by dad
No! You simply thought the evolution that did go on was all that went on.
This response does not appear to make sense given what it appeared to be intended to address. If special creation were true, we would not expect to get a single nested hierarchy from taxonomy.
Originally Posted by dad
Read this post, I did that. Creation + hyperevolution = whatwesee.
Your post has not explained how a single nested hierarchy of species is a required outcome of any form of creationism
'Gee, we have cells, and chromosomes with some structure, we are all a big happy family, the worms, and fungi and us'
That is your whole arguement. You have to go to school for that???!!!
Humans are eukaryotes. Fungii are eukaryotes. Plants are eukaryotes. How do you explain that?
Originally Posted by dad
I already covered that we don't know the past state, and how life processes were, and the retrovirus ancestor got around.
All we can see is that it was passed down. And where's that?
Yes, it was passed down from a common ancestor in which the original infection took place. And that individual would have been ancestral to humans and chimpanzees.
1) The germline invasion supposedly happened 25-30 mya before the OWM /NWM split.
That's plain wrong, the abstract of the article states that the PtERV intrusion happened roughly 3-4mya.
4) PtERV is found in African great apes and OWM but is absent in human and Asian great apes.
At non-orthologous positions, which makes all the difference.
The homology arguement you are using, and that is what it is, fails to provide consistant proof. I keep trying to track down what you guys are saying but I still don't find these mystery ERVs that you are talking about. Where are they, what are they called, what class of ERV are they?
Better yet, characterize an orthologous ERV insertion and identify it. I'm getting tired of seeing this talked in circles, where are these mystery ERVs you guys want to pontificate about endlessly?
Nothing is going to be dealt with until you identify these ERVs you are making such a fuss about.
Here's a good old one:
Unique cellular flanking-sequence probes (Fig. 1) have
been used to locate individual proviral genomes to human
chromosomes 1 and 5 and to detect unique integration sites
(13). A single 7.3-kbp fragment generated by double digestion
with EcoRI-XhoI hybridized to both the HLM-2 gag
region and the 5' unique cellular flanking-sequence probes
(Fig. 1 and SA). As in the transfectant and the human (Fig.
5A and B, lanes 1 and 2, respectively), common chimpanzee
and gorilla DNAs showed the single 7.3-kbp EcoRI-XhoI
fragment when the HLM-2 5'-flanking probe was used (Fig.
5B, lanes 3 and 4). This suggests that the genomic DNAs of
the two African apes contain the HLM-2 proviral genome at
the same site as does the human genomic DNA. Although
EcoRI-XhoI digests of orangutan DNAs resolved a 7.3-kbp
fragment, additional low-molecular-weight bands appeared
(Fig. 5B, lane 5). In contrast to those of the three large apes,
DNAs from the lesser ape lar gibbon did not cross-hybridize
to the HLM-2 gag probe (Fig. 4D) or to the HLM-2 5' unique
cellular flanking-sequence probe (data not shown) at high
stringency. This is consistent with the lack of characteristic
HLM-2 proviral internal fragments, e.g., env (Fig. 4A and B)
and pol (data not shown), and suggests that, although lar
gibbon DNA has HERVII-related sequences, it does not
contain the HLM-2 proviral genome.
The presence of the HLM-2 provirus in large apes and
humans corresponds to their phylogenetic relationships instead
of their current geographic distribution (8, 11, 12, 14,
20, 21, 25). The observed hybridization patterns suggest
either that the human HLM-2 proviral genome was inherited
from a common ancestor of all the extant large hominoids
after the divergence of the lesser ape lineage (11) or that this
region of the lar gibbon genome was lost subsequent to the
divergence of lar gibbons from large hominoids. We favor
the former possibility, since the restriction patterns of HLM-
2 proviral env, gag, and flanking sequences are consistent
with the evolutionary branching order of orangutans, African
apes, and humans (11, 21). This issue should be resolved
with studies using additional cellular DNA probes flanking
the HLM-2 provirus or other HERVII proviral genomes. In
this regard, another human endogenous proviral genome,
ERV-1, which is unrelated to the HERVII family, is known
to have entered the human germ line prior to the chimpanzee-
human branch point (3).
The possibility that the HERVII family of endogenous
retrovirus sequences entered the catarrhine lineage via an
ancient infection is suggested by the following observations: the presence of all the HERVII internal sequences in all the
species of Old World simian primates tested, the similarity of
HLM-2 proviral patterns in humans and large apes, and the
absence of HERVII structural sequences in New World
monkeys. A HERVII infection of early catarrhines would
therefore have occurred after the geographic separation
between the Old and the New World anthropoid lineages,
i.e., approximately 40 million years ago (7, 9-11) but before
the evolutionary radiation and geographic dispersal (outside
Africa) of the ancestors of the extent large hominoids
(estimated at 17 million years ago) (1, 2, 19, 24).
And who that has understanding will suppose that the first, and second, and third day, and the evening and the morning, existed without a sun, and moon, and stars? - Origen, 215AD [De Principiis 4.1.16]
The nested hierarchy of species existed prior to our explaining it. Absent common ancestry it doesn't make sense. But its existence is not in doubt.
It existed prior to evolution because it has nothing to do with evolution. AS I pointed out, nothing about it precludes the ancestor created kinds, that have undrgone great rapid evolution.
In this case, it was originally Carl Linnaeus, a devout christian. But that's not really important right now. What is important is that this arrangement of species is not arbitrary. It is actually a natural, nested hierarchy. This means that we do not find species that should be classified in multiple taxa. Try grouping created objects into a nested hierarchy without finding out that something belongs in more than one group.
When you get to genus, it seems we are getting pretty close to the created kinds. Some might say it was family. Beyond that, the grouping really has not got much meaning.
Persdonal distate for something is not actually a valid argument against it. And no, taxonomy is nothing like your characterization of it. It is more like saying that eukaryotes are all species that have a cell nucleus and other internal organelles.
Right, which is saying nothing much at all really, is it? That is a ridiculously broad cath phrase that catches almost everything normally thought of as creatures.
Or that Deuterstomes are all species that develop an anus before a mouth.
Now that is something evos might be interested in.
Interesting fact, all chordates are deuterstomes. I've yet to have a creationist explain why this must be so.
What is interesting about it? Why would the average person, or creationist care?
How does rapid divergence of created kinds lead to a single nested hierarchy of species?
Simple,
"..placing all living beings in a nested structure of divisions related to their probable evolutionary descent. " wickopedia
So, if we had a lot of adapting and evolving we have a lot of creatures that muddle the picture of what 'probable evolution' might be! If a cat from Noah's ark adapted, and evolved into 30 something species.
"Linnaeus originally classified all the cats into a single genus, Felis within the Felidae family. However, there were obviously cats of several broad types and zoologists began to group these together and added new genera in the process. At one point the single genus Felis had diversified into no less than 23 different genera. Many experts believed that the splitting up had gone too far and there was a tendency to regroup. This tendency continued until a few years ago, when most authorities considered that there were just three genera - Felis for all the small cats, Panthera for the big cats (which are defined by their ability to roar) and Acinonyx for the cheetah. " http://www.bigcats.org/abc/catspecies/species.html
So, if all these came as evolved species from the one on the ark, where does that leave your little ever changing classification system!!!!?? Even if we had, say, a couple on the ark, and maybe just the one in Eden to start!!!!?
No, most likely meaning most parsimoneous. That is, it builds a phylogeny that makes the fewest assumptions. These methods will work with any type of object, doesn't even need to be biological. You just won't get very good statistical support for your results.
Right, I can do that as well, and not omit creation for a wonderful simple picture. Using as a starting point, the same creatures we see here today.
No, what we do is run the algorithms on various taxa, using relevent character matrices to test hypotheses about relationships.
Do you run the two cats on the ark in there, and all the species that evolved since? The one elephant? The one horse pair? Etc? Do you run the adapting that went on for 1600 years before that as well, in other life here? Is God omitted in the relationship?
What we find is that results of such independent tests are consistent. This supports the hypotheses that there is a single, true phylogeny of living things.
I'm sure. Which is why it is a statement of faith, and nothing in this world more. Just because it is based on the creation, and subsequent adaptations, doesn't mean you can understand it by assuming we came from worms!!
If special creation were true, we would not expect to get a single nested hierarchy from taxonomy.
I think I just covered that.
Humans are eukaryotes. Fungii are eukaryotes. Plants are eukaryotes. How do you explain that?
Easy as pie! You like to call plants, and humans by a common name! Pretty silly name at that. I mean, someone could say, all things with eyes or sonar, or hearing, are Percepterians. Then I could say you and fish, and all kinds of things are percepterians. So?? Your desperation in finding something in common with fungi, and worms is becoming a concern here! And, no, I am not a fungaphobic.
Yes, it was passed down from a common ancestor in which the original infection took place. And that individual would have been ancestral to humans and chimpanzees.
Not if the ancestor of the retrovirus, in the different past could jump species, unlike now! Then, as I say, it would get passed down by the kinds of species it was in, down the line! This means we need no common ancestor to explain ERVs at all.
If you want to talk other things, as I said, we could have seen some wicked pre flood man monkey action.
__________________ The present is...NOT...the key to the past. That is where science messed up. The future is the key to the past.
Linear Mode
