Give me one beneficial mutation.

3sigma · #21 4th September 2010, 12:00 AM

Originally Posted by Heaven-Sent

I am not an expert in the field of biology, but I am willing to take one on.

You admit that you know little of biology, yet you think you can effectively debate an expert in the field. I think there’s a word for that.

In any case, you asked for a single instance of evidence of a beneficial mutation. You’ve been given several now by people who appear to know a good deal more on the subject than you. Are you ready now to take the advice in your signature?

Exiledoomsayer · #22 4th September 2010, 12:12 AM

Heaven-Sent,

There are three things i would like you to do.
1. Define "mutation"
2. Give a example of a non-beneficial mutation
3. Define beneficial

I think that between the three of them the goalposts should be fairly steadily locked down.

Flatland · #23 4th September 2010, 12:48 AM

Originally Posted by Heaven-Sent

I
My cat eats cat food, but will also eat yogurt if I drop it on the floor. I made a smoothie earlier and some split on the ground, she ate that too. Like a vacuum cleaner, but no work involved.

Can your cat digest Nylon?

Let me ask you this....what would you accept as a "beneficial mutation?"

Originally Posted by Heaven-Sent

All of these are just using added existing code.

So what would qualify as new code?

You have no idea what you're talking about do you?

Originally Posted by Agonaces of Susa

Creationism is beneficial, however some would argue it's not a mutation.

Sane people will argue that creationism doesn't exist

Flatland · #24 4th September 2010, 01:10 AM

Is is any of our local creatins going to give us an example of what a beneficial mutation would look like? Some how I highly doubt it...

Here, I'll even give you a hand. Below is an example of a genetic sequence:
acaagatgcc attgtccccc ggcctcctgc

Now please show us what a "beneficial mutation" should look like.

greenery · #25 4th September 2010, 01:55 AM

Originally Posted by Flatland

Is is any of our local creatins going to give us an example of what a beneficial mutation would look like? Some how I highly doubt it...

Here, I'll even give you a hand. Below is an example of a genetic sequence:
acaagatgcc attgtccccc ggcctcctgc

Now please show us what a "beneficial mutation" should look like.

Please remember that creationists are designed to be parrots and as such are only capable of repeating what they have been told, they know nothing about the questions they ask and would not understand any answers they were given.

I often think a creationists is like a person who learns to asks what the time is in a foreign language,
they can ask the question but are unable to understand the answer.

When a creationist gains actual knowledge they soon stop being creationists.

MoonLancer · #26 4th September 2010, 02:19 AM

Originally Posted by Heaven-Sent

My cat eats cat food, but will also eat yogurt if I drop it on the floor. I made a smoothie earlier and some split on the ground, she ate that too. Like a vacuum cleaner, but no work involved.

Can your cat digest nylons and actually use it as food?

If you cant understand the answer to the question you asked, it will always seem unanswered. You probably cant even explain what type of answer your looking for. And if you cant do this then their is no point to answering your questions.

Heaven-Sent · #27 4th September 2010, 03:22 AM

In every case given here, the mutation involves existing code. Show me the addition of new code. To put it simply:

A car has many parts. To make it run faster, louder, or more efficiently I can change the arrangement of parts, add more of the existing parts, or take parts away. In every case I am not adding anything new to the car.

This is how all of the mutations listed in this thread have been. I've yet to see something with new code.

See sig...

Flatland · #28 4th September 2010, 03:59 AM

Originally Posted by Heaven-Sent

In every case given here, the mutation involves existing code. Show me the addition of new code. To put it simply:

A car has many parts. To make it run faster, louder, or more efficiently I can change the arrangement of parts, add more of the existing parts, or take parts away. In every case I am not adding anything new to the car.

This is how all of the mutations listed in this thread have been. I've yet to see something with new code.

See sig...

Here's an example of a genetic sequence:
acaagatgccattgtcccccggcctcctgc

Please give us an example of what "new code" would look like.

If you're not going to tell us what you would accept as "new code" then you have no business asking for it.

Heaven-Sent · #29 4th September 2010, 04:02 AM

how about adding any letter besides a, c, g, or t.

Flatland · #30 4th September 2010, 04:03 AM

Originally Posted by Heaven-Sent

how about adding any letter besides a, c, g, or t.

And what letters would that be? Do you even know what those letters stand for?