Home | Be a Christian | Devotionals | Join Us! | Forums | Rules | F.A.Q.


Go Back   Christian Forums > Society > Society > Physical & Life Sciences > Creation & Evolution
Register BlogsPrayersJobsArcade Calendar Mark Forums Read

Creation & Evolution Forum for the discussion of this important topic. This forum is open to non-believers. There is a Christians-only forum in the Christians-only section too.

Reply
 
LinkBack Thread Tools Display Modes
  #21  
Old 4th September 2010, 12:00 AM
Senior Veteran

Faith: Atheist Member For 5 Years
 
Join Date: 9th January 2008
Posts: 2,447
Blessings: 3,094,882
Reps: 241,692,970,520,611 (power: 0)
3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute
3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute3sigma has a reputation beyond repute
Originally Posted by Heaven-Sent View Post
I am not an expert in the field of biology, but I am willing to take one on.
You admit that you know little of biology, yet you think you can effectively debate an expert in the field. I think there’s a word for that.

In any case, you asked for a single instance of evidence of a beneficial mutation. You’ve been given several now by people who appear to know a good deal more on the subject than you. Are you ready now to take the advice in your signature?
Reply With Quote
Become a CF Site Supporter Today and Make These Ads Go Away!

  #22  
Old 4th September 2010, 12:12 AM
Exiledoomsayer's Avatar
Only toke me 1 year to work out how to change this

Gender: Male Faith: Atheist Member For 3 Years
 
Join Date: 7th January 2010
Posts: 2,188
Blessings: 1,044,015
My Mood Lurking
Reps: 74,687,208,637,708,112 (power: 74,687,208,637,714)
Exiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond repute
Exiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond reputeExiledoomsayer has a reputation beyond repute
Heaven-Sent,

There are three things i would like you to do.
1. Define "mutation"
2. Give a example of a non-beneficial mutation
3. Define beneficial

I think that between the three of them the goalposts should be fairly steadily locked down.
Reply With Quote
  #23  
Old 4th September 2010, 12:48 AM
Junior Member

Gender: Male Faith: Atheist Member For 2 Years
 
Join Date: 25th August 2010
Posts: 201
Blessings: 17,632
Reps: 126,218,909,373,659 (power: 126,218,909,376)
Flatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond repute
Flatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond repute
Originally Posted by Heaven-Sent View Post
I
My cat eats cat food, but will also eat yogurt if I drop it on the floor. I made a smoothie earlier and some split on the ground, she ate that too. Like a vacuum cleaner, but no work involved.
Can your cat digest Nylon?


Let me ask you this....what would you accept as a "beneficial mutation?"

Originally Posted by Heaven-Sent View Post
All of these are just using added existing code.
So what would qualify as new code?

You have no idea what you're talking about do you?

Originally Posted by Agonaces of Susa View Post
Creationism is beneficial, however some would argue it's not a mutation.
Sane people will argue that creationism doesn't exist

Last edited by Flatland; 4th September 2010 at 01:03 AM.
Reply With Quote
  #24  
Old 4th September 2010, 01:10 AM
Junior Member

Gender: Male Faith: Atheist Member For 2 Years
 
Join Date: 25th August 2010
Posts: 201
Blessings: 17,632
Reps: 126,218,909,373,659 (power: 126,218,909,376)
Flatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond repute
Flatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond repute
Is is any of our local creatins going to give us an example of what a beneficial mutation would look like? Some how I highly doubt it...

Here, I'll even give you a hand. Below is an example of a genetic sequence:
acaagatgcc attgtccccc ggcctcctgc

Now please show us what a "beneficial mutation" should look like.
Reply With Quote
  #25  
Old 4th September 2010, 01:55 AM
Junior Member

Gender: Female Faith: Protestant Member For 2 Years
 
Join Date: 31st August 2010
Posts: 37
Blessings: 59,125
Reps: 9,223,372,036,854,834 (power: 9,223,372,036,857)
greenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond repute
greenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond reputegreenery has a reputation beyond repute
Originally Posted by Flatland View Post
Is is any of our local creatins going to give us an example of what a beneficial mutation would look like? Some how I highly doubt it...

Here, I'll even give you a hand. Below is an example of a genetic sequence:
acaagatgcc attgtccccc ggcctcctgc

Now please show us what a "beneficial mutation" should look like.
Please remember that creationists are designed to be parrots and as such are only capable of repeating what they have been told, they know nothing about the questions they ask and would not understand any answers they were given.

I often think a creationists is like a person who learns to asks what the time is in a foreign language,
they can ask the question but are unable to understand the answer.

When a creationist gains actual knowledge they soon stop being creationists.
Reply With Quote
  #26  
Old 4th September 2010, 02:19 AM
MoonLancer's Avatar
The Moon is a reflection of the MorningStar

Gender: Male Faith: Buddhist Member For 5 Years
 
Join Date: 10th August 2007
Posts: 5,789
Blessings: 4,082,974
My Mood Inspired
Blog Entries: 1
Reps: 56,734,881,133,185,528 (power: 56,734,881,133,196)
MoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond repute
MoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond reputeMoonLancer has a reputation beyond repute
Originally Posted by Heaven-Sent View Post
My cat eats cat food, but will also eat yogurt if I drop it on the floor. I made a smoothie earlier and some split on the ground, she ate that too. Like a vacuum cleaner, but no work involved.
Can your cat digest nylons and actually use it as food?

If you cant understand the answer to the question you asked, it will always seem unanswered. You probably cant even explain what type of answer your looking for. And if you cant do this then their is no point to answering your questions.
Reply With Quote
  #27  
Old 4th September 2010, 03:22 AM
Junior Member

Gender: Male Faith: Non-Denominational Member For 2 Years
 
Join Date: 3rd September 2010
Posts: 43
Blessings: 60,375
My Mood Cheerful
Reps: 20,252,428,237,681 (power: 20,252,428,240)
Heaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond repute
Heaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond repute
In every case given here, the mutation involves existing code. Show me the addition of new code. To put it simply:

A car has many parts. To make it run faster, louder, or more efficiently I can change the arrangement of parts, add more of the existing parts, or take parts away. In every case I am not adding anything new to the car.

This is how all of the mutations listed in this thread have been. I've yet to see something with new code.

See sig...
__________________
"There is nothing progressive about being pig headed and refusing to admit a mistake." C.S. Lewis
Reply With Quote
  #28  
Old 4th September 2010, 03:59 AM
Junior Member

Gender: Male Faith: Atheist Member For 2 Years
 
Join Date: 25th August 2010
Posts: 201
Blessings: 17,632
Reps: 126,218,909,373,659 (power: 126,218,909,376)
Flatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond repute
Flatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond repute
Originally Posted by Heaven-Sent View Post
In every case given here, the mutation involves existing code. Show me the addition of new code. To put it simply:

A car has many parts. To make it run faster, louder, or more efficiently I can change the arrangement of parts, add more of the existing parts, or take parts away. In every case I am not adding anything new to the car.

This is how all of the mutations listed in this thread have been. I've yet to see something with new code.

See sig...
Here's an example of a genetic sequence:
acaagatgccattgtcccccggcctcctgc

Please give us an example of what "new code" would look like.

If you're not going to tell us what you would accept as "new code" then you have no business asking for it.
Reply With Quote
  #29  
Old 4th September 2010, 04:02 AM
Junior Member

Gender: Male Faith: Non-Denominational Member For 2 Years
 
Join Date: 3rd September 2010
Posts: 43
Blessings: 60,375
My Mood Cheerful
Reps: 20,252,428,237,681 (power: 20,252,428,240)
Heaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond repute
Heaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond reputeHeaven-Sent has a reputation beyond repute
how about adding any letter besides a, c, g, or t.
__________________
"There is nothing progressive about being pig headed and refusing to admit a mistake." C.S. Lewis
Reply With Quote
  #30  
Old 4th September 2010, 04:03 AM
Junior Member

Gender: Male Faith: Atheist Member For 2 Years
 
Join Date: 25th August 2010
Posts: 201
Blessings: 17,632
Reps: 126,218,909,373,659 (power: 126,218,909,376)
Flatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond repute
Flatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond reputeFlatland has a reputation beyond repute
Originally Posted by Heaven-Sent View Post
how about adding any letter besides a, c, g, or t.
And what letters would that be? Do you even know what those letters stand for?
Reply With Quote
Reply


Return to Creation & Evolution

Thread Tools
Display Modes


 
Become a CF Site Supporter Today and Make These Ads Go Away!


All times are GMT -4. The time now is 06:21 PM.