| Creation & Evolution Forum for the discussion of this important topic. This forum is open to non-believers. There is a Christians-only forum in the Christians-only section too. |
 | | 
1st July 2005, 12:33 AM
|  | Cartomancer
41     
| | Join Date: 25th June 2003 Location: Puebla, Puebla
Posts: 205
Blessings: 93,493
Reps: 77,453 (power: 86) | |  A comparison of human genetic code with the genetic code of other primates
Let's look at a section of the genetic code for humans and some primates:
Code: Human AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGC
Chimp A T C A T
Gorilla TG T T A A T
Ora AC CC G T T A C CC G
Lemur TA A AC A A T C A CA T
In this chart, only the parts of the genetic sequence that differ between human and other primates are listed for non-humans. As we can see, the human is remarkably a lot like a chimp, a little less like a gorilla, even less like a Orangutan, and yet even less like a Lemur. What is the chance of this level of similarity from random chance alone?
There are four non-human species here. One differs in five codons, one in seven codons, one in 12 codons, and one in 13 codons. Doing some hairy math, we get the following table:
Code: Codon difference Chance of happening
5 1 in 43584035141688932777068455669
7 1 in 33433107027157641303274312
12 1 in 6175725839354732886
13 1 in 385982864959670805
So, the chances of all five animals having, by chance, this amount of codon difference is one in 3473443252963481966956495750331838528924011681856948698678902255299509633288176663138891440 This number is roughly 2 ^ 301
This shows beyond any reasonable doubt that the human species is genetically related to the Chimpanzee and other primates, and that the chance of our genetic code being similar to these other species because of random chance is, for all intents and purposes, zero.
__________________
Dios nos cuida
Dios nos ama
Dios nos bendice |
1st July 2005, 12:54 AM
| | Regular Member
25  
| | Join Date: 15th February 2005
Posts: 217
Blessings: 90,457
Reps: 68 (power: 0) | | | I'm not quite sure if you're arguing against evolution. But since when is evolution just random chance? The only thing random about evolution are the mutations that occur. Natural selection is completely non-random. |
1st July 2005, 01:00 AM
|  | Doc WinAce fan
 
| | Join Date: 4th April 2005 Location: Dana Point, CA
Posts: 1,382
Blessings: 91,107
Reps: 1,735 (power: 9) | | Well, let me antisipate some questions:
Why that segment?
How does that segment compare to any other randonly selected segment of equal length and equal genetic relevance?
I think you might have a good start for a evo/creto article of some merit, but a bit more detail and some more work is needed.
What are the contrasts between coding and noncoding regions, particularly bring in endogenous retroviral fragments ie: Welkin E. Johnson and John M. Coffin,
1999 "Constructing primate phylogenies from ancient retrovirus sequences" PNAS Vol. 96, Issue 18, 10254-10260, August 31, Heui-Soo Kim, Osamu Takenaka and Timothy J. Crow
1999 "Isolation and phylogeny of endogenous retrovirus sequences belonging to the HERV-W family in primates" Journal of General Virology (1999), 80, 2613-2619 John Hawks, Keith Hunley, Sang-Hee Lee and Milford Wolpoff
2000 "Population Bottlenecks and Pleistocene Human Evolution" Molecular Biology and Evolution 17:2-22 (2000) |
1st July 2005, 01:00 AM
| | Senior Veteran
| | Join Date: 28th August 2004
Posts: 2,000
Blessings: 91,792
Reps: 2,843 (power: 12) | | Originally Posted by 235U92 I'm not quite sure if you're arguing against evolution. But since when is evolution just random chance? The only thing random about evolution are the mutations that occur. Natural selection is completely non-random.
He's saying the opposite, actually. That genetic comparisons show that the groupings of similarities makes "random chance" an inviable explanation.
However, theists generally claim divine design. With the added bonus (for them) of not actually being able to test that assertion.
Last edited by mikeynov; 1st July 2005 at 01:07 AM.
|
1st July 2005, 01:06 AM
| | Regular Member
25
| | Join Date: 15th February 2005
Posts: 217
Blessings: 90,457
Reps: 68 (power: 0) | | Originally Posted by mikeynov He's saying the opposite, actually. That genetic comparisons show that the groupings of similarities makes "random chance" an inviable explanation.
However, theists generally claim design intent. With the added bonus (for them) of not actually being able to test that assertion.
Ah... wait. So he's arguing for Intelligent Design of some sort? |
1st July 2005, 01:08 AM
| | Senior Veteran
| | Join Date: 28th August 2004
Posts: 2,000
Blessings: 91,792
Reps: 2,843 (power: 12) | | Originally Posted by 235U92 Ah... wait. So he's arguing for Intelligent Design of some sort?
No 
He appears to be arguing for common ancestry. In short, he's suggesting evolution is true.
I was just commenting that theist anti-evolutionists would probably respond to an argument like this by saying "well God wanted it that way." Which, of course, doesn't explain anything at all, and is certainly not scientific. |
1st July 2005, 01:10 AM
| | Cartomancer
41
| | Join Date: 25th June 2003 Location: Puebla, Puebla
Posts: 205
Blessings: 93,493
Reps: 77,453 (power: 86) | | | To clarify
__________________
Dios nos cuida
Dios nos ama
Dios nos bendice |
1st July 2005, 01:13 AM
| | Regular Member
25
| | Join Date: 15th February 2005
Posts: 217
Blessings: 90,457
Reps: 68 (power: 0) | | Originally Posted by mikeynov No
He appears to be arguing for common ancestry. In short, he's suggesting evolution is true.
I was just commenting that theist anti-evolutionists would probably respond to an argument like this by saying "well God wanted it that way." Which, of course, doesn't explain anything at all, and is certainly not scientific.
Bah. I are confused. 
It sounded like he was arguing against it and saying it was just "random chance", which it is not.
This is what I get for being somewhat new to evolutionary biology. |
1st July 2005, 01:15 AM
|  | PraxAce
43 
 | | Join Date: 3rd September 2002 Location: Hobart, Tasmania. (And yes, there is such an animal as a Tasmanian devil)
Posts: 12,522
Blessings: 157,398
Reps: 23,030 (power: 45) | | Originally Posted by 235U92 Bah. I are confused.
It sounded like he was arguing against it and saying it was just "random chance", which it is not.
This is what I get for being somewhat new to evolutionary biology.
Pheh.
At 19, you're still just somewhat new, full stop.
__________________
To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.
To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.
|
1st July 2005, 01:17 AM
| | PraxAce
43
| | Join Date: 3rd September 2002 Location: Hobart, Tasmania. (And yes, there is such an animal as a Tasmanian devil)
Posts: 12,522
Blessings: 157,398
Reps: 23,030 (power: 45) | | Originally Posted by samiam
Well, yes and no.
YECists have a pat (if unscientific) answer to that, being common designer. They argue that the common designer simply used similar DNA were it was applicable to species that just so happen to look similar.
__________________
To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.
To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.
| | |
| Thread Tools | | | | Display Modes |  Linear Mode |
| | |
