Home | Be a Christian | Devotionals | Join Us! | Forums | Rules | F.A.Q.


Go Back   Christian Forums > Society > Society > Physical & Life Sciences > Creation & Evolution
Register BlogsPrayersJobsArcade Calendar Mark Forums Read

Creation & Evolution Forum for the discussion of this important topic. This forum is open to non-believers. There is a Christians-only forum in the Christians-only section too.

Reply
 
LinkBack Thread Tools Display Modes
  #1  
Old 1st July 2005, 12:33 AM
samiam's Avatar
Cartomancer

41 Gender: Male Faith: Catholic Party: US-Democrat Country: Mexico Member For 5 Years
 
Join Date: 25th June 2003
Location: Puebla, Puebla
Posts: 205
Blessings: 93,493
Reps: 77,453 (power: 86)
samiam is a splendid one to behold
samiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to behold
Idea A comparison of human genetic code with the genetic code of other primates

Let's look at a section of the genetic code for humans and some primates:
Code:
Human      AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGC
Chimp                      A T  C                 A               T
Gorilla                      TG    T     T        A        A      T
Ora                        AC  CC     G  T     T  A  C        CC    G
Lemur              TA  A   AC      A        A  T   C       A  CA  T
In this chart, only the parts of the genetic sequence that differ between human and other primates are listed for non-humans. As we can see, the human is remarkably a lot like a chimp, a little less like a gorilla, even less like a Orangutan, and yet even less like a Lemur. What is the chance of this level of similarity from random chance alone?

There are four non-human species here. One differs in five codons, one in seven codons, one in 12 codons, and one in 13 codons. Doing some hairy math, we get the following table:

Code:
Codon difference           Chance of happening
5                          1 in 43584035141688932777068455669
7                          1 in 33433107027157641303274312
12                         1 in 6175725839354732886
13                         1 in 385982864959670805

So, the chances of all five animals having, by chance, this amount of codon difference is one in 3473443252963481966956495750331838528924011681856948698678902255299509633288176663138891440

This number is roughly 2 ^ 301

This shows beyond any reasonable doubt that the human species is genetically related to the Chimpanzee and other primates, and that the chance of our genetic code being similar to these other species because of random chance is, for all intents and purposes, zero.

__________________
Dios nos cuida
Dios nos ama
Dios nos bendice
Reply With Quote
Become a CF Site Supporter Today and Make These Ads Go Away!

  #2  
Old 1st July 2005, 12:54 AM
Regular Member

25 Gender: Male Faith: Agnostic Country: Antarctica Member For 5 Years
 
Join Date: 15th February 2005
Posts: 217
Blessings: 90,457
Reps: 68 (power: 0)
235U92 will become famous soon enough
I'm not quite sure if you're arguing against evolution. But since when is evolution just random chance? The only thing random about evolution are the mutations that occur. Natural selection is completely non-random.
Reply With Quote
  #3  
Old 1st July 2005, 01:00 AM
Dr.GH's Avatar
Doc WinAce fan

Gender: Male Faith: Taoist Country: United States Member For 5 Years
 
Join Date: 4th April 2005
Location: Dana Point, CA
Posts: 1,382
Blessings: 91,107
Reps: 1,735 (power: 9)
Dr.GH has disabled reputation
Well, let me antisipate some questions:

Why that segment?

How does that segment compare to any other randonly selected segment of equal length and equal genetic relevance?

I think you might have a good start for a evo/creto article of some merit, but a bit more detail and some more work is needed.

What are the contrasts between coding and noncoding regions, particularly bring in endogenous retroviral fragments ie:

Welkin E. Johnson and John M. Coffin,
1999 "Constructing primate phylogenies from ancient retrovirus sequences" PNAS Vol. 96, Issue 18, 10254-10260, August 31,


Heui-Soo Kim, Osamu Takenaka and Timothy J. Crow
1999 "Isolation and phylogeny of endogenous retrovirus sequences belonging to the HERV-W family in primates" Journal of General Virology (1999), 80, 2613-2619


John Hawks, Keith Hunley, Sang-Hee Lee and Milford Wolpoff
2000 "Population Bottlenecks and Pleistocene Human Evolution" Molecular Biology and Evolution 17:2-22 (2000)
Reply With Quote
  #4  
Old 1st July 2005, 01:00 AM
Senior Veteran

Faith: Atheist Member For 5 Years
 
Join Date: 28th August 2004
Posts: 2,000
Blessings: 91,792
Reps: 2,843 (power: 12)
mikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of light
Originally Posted by 235U92
I'm not quite sure if you're arguing against evolution. But since when is evolution just random chance? The only thing random about evolution are the mutations that occur. Natural selection is completely non-random.
He's saying the opposite, actually. That genetic comparisons show that the groupings of similarities makes "random chance" an inviable explanation.

However, theists generally claim divine design. With the added bonus (for them) of not actually being able to test that assertion.

Last edited by mikeynov; 1st July 2005 at 01:07 AM.
Reply With Quote
  #5  
Old 1st July 2005, 01:06 AM
Regular Member

25 Gender: Male Faith: Agnostic Country: Antarctica Member For 5 Years
 
Join Date: 15th February 2005
Posts: 217
Blessings: 90,457
Reps: 68 (power: 0)
235U92 will become famous soon enough
Originally Posted by mikeynov
He's saying the opposite, actually. That genetic comparisons show that the groupings of similarities makes "random chance" an inviable explanation.

However, theists generally claim design intent. With the added bonus (for them) of not actually being able to test that assertion.
Ah... wait. So he's arguing for Intelligent Design of some sort?
Reply With Quote
  #6  
Old 1st July 2005, 01:08 AM
Senior Veteran

Faith: Atheist Member For 5 Years
 
Join Date: 28th August 2004
Posts: 2,000
Blessings: 91,792
Reps: 2,843 (power: 12)
mikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of lightmikeynov is a glorious beacon of light
Originally Posted by 235U92
Ah... wait. So he's arguing for Intelligent Design of some sort?
No

He appears to be arguing for common ancestry. In short, he's suggesting evolution is true.

I was just commenting that theist anti-evolutionists would probably respond to an argument like this by saying "well God wanted it that way." Which, of course, doesn't explain anything at all, and is certainly not scientific.
Reply With Quote
  #7  
Old 1st July 2005, 01:10 AM
samiam's Avatar
Cartomancer

41 Gender: Male Faith: Catholic Party: US-Democrat Country: Mexico Member For 5 Years
 
Join Date: 25th June 2003
Location: Puebla, Puebla
Posts: 205
Blessings: 93,493
Reps: 77,453 (power: 86)
samiam is a splendid one to behold
samiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to beholdsamiam is a splendid one to behold
To clarify

We very genetically similar to other primates. This makes (or has made) some creationists a little jittery, e.g:

http://www.harunyahya.com/ramadan_pages_day28.php
http://members.cox.net/ardipithecus/evol/HovindLie.html
http://members.aol.com/dwise1/cre_ev/bullfrog.html

- Sam

__________________
Dios nos cuida
Dios nos ama
Dios nos bendice
Reply With Quote
  #8  
Old 1st July 2005, 01:13 AM
Regular Member

25 Gender: Male Faith: Agnostic Country: Antarctica Member For 5 Years
 
Join Date: 15th February 2005
Posts: 217
Blessings: 90,457
Reps: 68 (power: 0)
235U92 will become famous soon enough
Originally Posted by mikeynov
No

He appears to be arguing for common ancestry. In short, he's suggesting evolution is true.

I was just commenting that theist anti-evolutionists would probably respond to an argument like this by saying "well God wanted it that way." Which, of course, doesn't explain anything at all, and is certainly not scientific.
Bah. I are confused.

It sounded like he was arguing against it and saying it was just "random chance", which it is not.

This is what I get for being somewhat new to evolutionary biology.
Reply With Quote
  #9  
Old 1st July 2005, 01:15 AM
Praxiteles's Avatar
PraxAce

43 Gender: Male Faith: Agnostic Country: Australia Member For 5 Years
View Profile Pic
 
Join Date: 3rd September 2002
Location: Hobart, Tasmania. (And yes, there is such an animal as a Tasmanian devil)
Posts: 12,522
Blessings: 157,398
Reps: 23,030 (power: 45)
Praxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to behold
Praxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to behold
Originally Posted by 235U92
Bah. I are confused.

It sounded like he was arguing against it and saying it was just "random chance", which it is not.

This is what I get for being somewhat new to evolutionary biology.
Pheh.

At 19, you're still just somewhat new, full stop.

__________________

To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.

To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.
Reply With Quote
  #10  
Old 1st July 2005, 01:17 AM
Praxiteles's Avatar
PraxAce

43 Gender: Male Faith: Agnostic Country: Australia Member For 5 Years
View Profile Pic
 
Join Date: 3rd September 2002
Location: Hobart, Tasmania. (And yes, there is such an animal as a Tasmanian devil)
Posts: 12,522
Blessings: 157,398
Reps: 23,030 (power: 45)
Praxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to behold
Praxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to beholdPraxiteles is a splendid one to behold
Originally Posted by samiam
We very genetically similar to other primates. This makes (or has made) some creationists a little jittery, e.g:

http://www.harunyahya.com/ramadan_pages_day28.php
http://members.cox.net/ardipithecus/evol/HovindLie.html
http://members.aol.com/dwise1/cre_ev/bullfrog.html

- Sam

Well, yes and no.

YECists have a pat (if unscientific) answer to that, being common designer. They argue that the common designer simply used similar DNA were it was applicable to species that just so happen to look similar.
__________________

To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.

To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.
Reply With Quote
Reply


Return to Creation & Evolution

Thread Tools
Display Modes


 
Become a CF Site Supporter Today and Make These Ads Go Away!


All times are GMT -4. The time now is 01:35 AM.