Creation & EvolutionForum for the discussion of this important topic. This forum is open to non-believers. There is a Christians-only forum in the Christians-only section too.
A comparison of human genetic code with the genetic code of other primates
Let's look at a section of the genetic code for humans and some primates:
Code:
Human AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGC
Chimp A T C A T
Gorilla TG T T A A T
Ora AC CC G T T A C CC G
Lemur TA A AC A A T C A CA T
In this chart, only the parts of the genetic sequence that differ between human and other primates are listed for non-humans. As we can see, the human is remarkably a lot like a chimp, a little less like a gorilla, even less like a Orangutan, and yet even less like a Lemur. What is the chance of this level of similarity from random chance alone?
There are four non-human species here. One differs in five codons, one in seven codons, one in 12 codons, and one in 13 codons. Doing some hairy math, we get the following table:
Code:
Codon difference Chance of happening
5 1 in 43584035141688932777068455669
7 1 in 33433107027157641303274312
12 1 in 6175725839354732886
13 1 in 385982864959670805
So, the chances of all five animals having, by chance, this amount of codon difference is one in 3473443252963481966956495750331838528924011681856948698678902255299509633288176663138891440
This number is roughly 2 ^ 301
This shows beyond any reasonable doubt that the human species is genetically related to the Chimpanzee and other primates, and that the chance of our genetic code being similar to these other species because of random chance is, for all intents and purposes, zero.
__________________ Dios nos cuida
Dios nos ama
Dios nos bendice
I'm not quite sure if you're arguing against evolution. But since when is evolution just random chance? The only thing random about evolution are the mutations that occur. Natural selection is completely non-random.
I'm not quite sure if you're arguing against evolution. But since when is evolution just random chance? The only thing random about evolution are the mutations that occur. Natural selection is completely non-random.
He's saying the opposite, actually. That genetic comparisons show that the groupings of similarities makes "random chance" an inviable explanation.
However, theists generally claim divine design. With the added bonus (for them) of not actually being able to test that assertion.
Last edited by mikeynov; 1st July 2005 at 01:07 AM.
Ah... wait. So he's arguing for Intelligent Design of some sort?
No
He appears to be arguing for common ancestry. In short, he's suggesting evolution is true.
I was just commenting that theist anti-evolutionists would probably respond to an argument like this by saying "well God wanted it that way." Which, of course, doesn't explain anything at all, and is certainly not scientific.
He appears to be arguing for common ancestry. In short, he's suggesting evolution is true.
I was just commenting that theist anti-evolutionists would probably respond to an argument like this by saying "well God wanted it that way." Which, of course, doesn't explain anything at all, and is certainly not scientific.
Bah. I are confused.
It sounded like he was arguing against it and saying it was just "random chance", which it is not.
This is what I get for being somewhat new to evolutionary biology.
YECists have a pat (if unscientific) answer to that, being common designer. They argue that the common designer simply used similar DNA were it was applicable to species that just so happen to look similar.
__________________
To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.
To view links or images in signatures your post count must be 10 or greater. You currently have 0 posts.
A comparison of human genetic code with the genetic code of other primates 
Linear Mode
