| Creation & Evolution Forum for the discussion of this important topic. This forum is open to non-believers. There is a Christians-only forum in the Christians-only section too. |  | | 
1st July 2005, 04:07 AM
|  | Cartomancer 41  | | Join Date: 25th June 2003 Location: Puebla, Puebla
Posts: 205
Blessings: 93,573
Reps: 77,453 (power: 86) | | Originally Posted by Justin Horne Allright.. my mind is tired of a,u,g,u,.... regardless...
Assuming the first codon list is 5'--->3' you get this encoded:
UUCGAAGUGGCCGCGUCAGUAAGAGUAUUAGCGGGUGCCCGAAUGUAGGAGUAAUGAUAAGACG
At least you should, I'm tired.
The only aug is near the end... Assuming the original list is 3'--->5' it would place it near the beginning, which would give you a long list of amino acids to check...
That's all for now folks. If it helps any, this fragment came from a mitochondrial sequence. All of the changes you see were caused by mutations; no sexual selection in this sequence. I made the sequence 64 codons long because that works out to 128 bits, which is an easier number for computers to deal with, nothing more, nothing less. I didn't have the original source for the sequences in front of me...I copied the list from a fuzzy GIF image. While I have taken Biology 10, they barely touched on genetics in the class (and, yes, I got an A, and yes my lab instructor was a geneticist, but I didn't have time to learn anything really useful about genetics); this chart came from a Linguistics class and was an aside in a longer lecture about the origin of language.
The original post was more geared to people who aren't aware at all about the genetic evidence for evolution (or, at least, tree-like differences between all species on the planet which indicates a really weird design aesetic or evolution)
I don't know; if I had only seven days to create all of the species, I would probably create a single master design then have all the animals be 80-90% like the design; the structure wouldn't be a tree but would have sudden 10-30% differences between the various animals. I probably wouldn't end up with such a tree-like structure; a design like that would take too long. 
- Sam
__________________ Dios nos cuida
Dios nos ama
Dios nos bendice | 
1st July 2005, 05:34 AM
|  | Doc WinAce fan
 | | Join Date: 4th April 2005 Location: Dana Point, CA
Posts: 1,382
Blessings: 91,187
Reps: 1,735 (power: 9) | | Originally Posted by Sam "I probably wouldn't end up with such a tree-like structure; a design like that would take too long."
Not if you had all the time in the Universe, and used evolution, or so I think. I like my front yard, and I mostly grow plants from seeds. I could just buy potted plants and stick them in the ground, but there is no art to that. I do not know which will grow, or what insect will polinate which flower. I think that you should extend your analysis with a long sequence, say an entire protein coding gene so that you could then compare the DNA similarity with the contrasting protein sequence- mtDNA would be fine to use, minimizing sexual recombination. That would be cool. | 
1st July 2005, 06:06 AM
|  | ScottBot is Stalking Me! 37 
| | Join Date: 10th September 2003 Location: Florida
Posts: 9,280
Blessings: 74,729
Reps: 28,708,582 (power: 28,726) | | Originally Posted by samiam Let's look at a section of the genetic code for humans and some primates: Code: Human AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGC
Chimp A T C A T
Gorilla TG T T A A T
Ora AC CC G T T A C CC G
Lemur TA A AC A A T C A CA T
In this chart, only the parts of the genetic sequence that differ between human and other primates are listed for non-humans. As we can see, the human is remarkably a lot like a chimp, a little less like a gorilla, even less like a Orangutan, and yet even less like a Lemur. What is the chance of this level of similarity from random chance alone? There are four non-human species here. One differs in five codons, one in seven codons, one in 12 codons, and one in 13 codons. Doing some hairy math, we get the following table: Code: Codon difference Chance of happening
5 1 in 43584035141688932777068455669
7 1 in 33433107027157641303274312
12 1 in 6175725839354732886
13 1 in 385982864959670805
So, the chances of all five animals having, by chance, this amount of codon difference is one in 3473443252963481966956495750331838528924011681856948698678902255299509633288176663138891440 This number is roughly 2 ^ 301 This shows beyond any reasonable doubt that the human species is genetically related to the Chimpanzee and other primates, and that the chance of our genetic code being similar to these other species because of random chance is, for all intents and purposes, zero.
That's right, it wasn't by chance. If I write two programs, they are going to have some of the same code.
__________________ Catholicism - Throwing demons on their heads since 33 AD | 
1st July 2005, 06:57 AM
| | Senior Veteran
 | | Join Date: 28th August 2004
Posts: 2,000
Blessings: 91,873
Reps: 2,843 (power: 12) | | Originally Posted by Dominus Fidelis That's right, it wasn't by chance. If I write two programs, they are going to have some of the same code.
Why do they have to have the code in that pattern, though?
These similarities hold in cases where the genetic basis doesn't even have a phenotypic effect - meaning that it doesn't affect structure/function of the organism.
So we have a pattern of similarity which suggests common descent, even in areas of the genome that aren't responsible for function.
What possible reason is there to design something like that? If we had common ancestry, it makes perfect sense. | 
1st July 2005, 07:01 AM
|  | ScottBot is Stalking Me! 37 
| | Join Date: 10th September 2003 Location: Florida
Posts: 9,280
Blessings: 74,729
Reps: 28,708,582 (power: 28,726) | | Originally Posted by mikeynov Why do they have to have the code in that pattern, though?
These similarities hold in cases where the genetic basis doesn't even have a phenotypic effect - meaning that it doesn't affect structure/function of the organism.
So we have a pattern of similarity which suggests common descent, even in areas of the genome that aren't responsible for function.
What possible reason is there to design something like that? If we had common ancestry, it makes perfect sense.
You are saying the code is present but has no effect?
__________________ Catholicism - Throwing demons on their heads since 33 AD | 
1st July 2005, 07:04 AM
| | Senior Veteran
 | | Join Date: 28th August 2004
Posts: 2,000
Blessings: 91,873
Reps: 2,843 (power: 12) | | Originally Posted by Dominus Fidelis You are saying the code is present but has no effect?
Correct.
You have the genetic material responsible for manufacturing vitamin C, for example. But you don't manufacture it, Dominus.
You also have the genetic material responsible for the formation of an honest-to-goodness tail. But you don't express that either. | 
1st July 2005, 07:29 AM
|  | ScottBot is Stalking Me! 37 
| | Join Date: 10th September 2003 Location: Florida
Posts: 9,280
Blessings: 74,729
Reps: 28,708,582 (power: 28,726) | | Originally Posted by mikeynov Correct.
You have the genetic material responsible for manufacturing vitamin C, for example. But you don't manufacture it, Dominus.
You also have the genetic material responsible for the formation of an honest-to-goodness tail. But you don't express that either.
Interesting, I'll have to research this code.
__________________ Catholicism - Throwing demons on their heads since 33 AD | 
1st July 2005, 08:26 AM
|  | ScottBot is Stalking Me! 37 
| | Join Date: 10th September 2003 Location: Florida
Posts: 9,280
Blessings: 74,729
Reps: 28,708,582 (power: 28,726) | | | I can't find info on this vitamin C code...can you link me to some please?
__________________ Catholicism - Throwing demons on their heads since 33 AD | 
1st July 2005, 08:31 AM
|  | WinAce > cdesign proponentsists 32 
| | Join Date: 24th June 2003 Location: Chiark
Posts: 18,443
Blessings: 125,874
Reps: 16,712 (power: 43) | | Originally Posted by Dominus Fidelis I can't find info on this vitamin C code...can you link me to some please?
you'll want the boring long name then, L-gulano-γ-lactone oxidase. where the middle thing is an alpha, not a y.
here is a bunch more info http://www.talkorigins.org/faqs/comd...l#mol_vestiges
basically what this means, is that we have a "crippled" form of the gene, which does nothing except sit there. the other great apes have a crippled gene too, and interestingly it is crippled in exactly the same way, with some additional mutations on top. when we form a tree of the mutations, we get the same tree as we get from any other molecular or fossil evidence (see the link below) such as ERV sequences, transposons and chromosome patterns. Interestingly the guinea pig also has a crippled version of this gene, but it is crippled in a different way, suggesting that it's damage is due to a different event to ours, which is what is expected.
here is some other complimentary evidence: http://www.christianforums.com/showt...34&postcount=9
__________________ MSci MSc ARCS DIC PhD..... yes, I am bragging. | 
1st July 2005, 08:40 AM
|  | ScottBot is Stalking Me! 37 
| | Join Date: 10th September 2003 Location: Florida
Posts: 9,280
Blessings: 74,729
Reps: 28,708,582 (power: 28,726) | | | Slight correction: Synthesis of Vitamin C, not manufacturing.
__________________ Catholicism - Throwing demons on their heads since 33 AD |  | | | Thread Tools | | | | Display Modes | Linear Mode | | | |