A comparison of human genetic code with the genetic code of other primates

Allright.. my mind is tired of a,u,g,u,.... regardless...

Assuming the first codon list is 5'--->3' you get this encoded:
UUCGAAGUGGCCGCGUCAGUAAGAGUAUUAGCGGGUGCCCGAAUGUAGGAGUAAUGAUAAGACG

At least you should, I'm tired.
The only aug is near the end... Assuming the original list is 3'--->5' it would place it near the beginning, which would give you a long list of amino acids to check...
That's all for now folks.

Let's look at a section of the genetic code for humans and some primates:

Code:

Human      AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGC
Chimp                      A T  C                 A               T
Gorilla                      TG    T     T        A        A      T
Ora                        AC  CC     G  T     T  A  C        CC    G
Lemur              TA  A   AC      A        A  T   C       A  CA  T

In this chart, only the parts of the genetic sequence that differ between human and other primates are listed for non-humans. As we can see, the human is remarkably a lot like a chimp, a little less like a gorilla, even less like a Orangutan, and yet even less like a Lemur. What is the chance of this level of similarity from random chance alone?

There are four non-human species here. One differs in five codons, one in seven codons, one in 12 codons, and one in 13 codons. Doing some hairy math, we get the following table:

Code:

Codon difference           Chance of happening
5                          1 in 43584035141688932777068455669
7                          1 in 33433107027157641303274312
12                         1 in 6175725839354732886
13                         1 in 385982864959670805

So, the chances of all five animals having, by chance, this amount of codon difference is one in 3473443252963481966956495750331838528924011681856948698678902255299509633288176663138891440

This number is roughly 2 ^ 301

This shows beyond any reasonable doubt that the human species is genetically related to the Chimpanzee and other primates, and that the chance of our genetic code being similar to these other species because of random chance is, for all intents and purposes, zero.

That's right, it wasn't by chance. If I write two programs, they are going to have some of the same code.

Why do they have to have the code in that pattern, though?

These similarities hold in cases where the genetic basis doesn't even have a phenotypic effect - meaning that it doesn't affect structure/function of the organism.

So we have a pattern of similarity which suggests common descent, even in areas of the genome that aren't responsible for function.

What possible reason is there to design something like that? If we had common ancestry, it makes perfect sense.

You are saying the code is present but has no effect?

Correct.

You have the genetic material responsible for manufacturing vitamin C, for example. But you don't manufacture it, Dominus.

You also have the genetic material responsible for the formation of an honest-to-goodness tail. But you don't express that either.

I can't find info on this vitamin C code...can you link me to some please?